Skip to main content

Table 2 Primers used for qPCR

From: Simvastatin re-sensitizes hepatocellular carcinoma cells to sorafenib by inhibiting HIF-1α/PPAR-γ/PKM2-mediated glycolysis

Gene nameForward (5′-3′)Reverse (5′-3′)
PKM2ATGTCGAAGCCCCATAGTGAATGGGTGGTGAATCAATGTCCA
HK2GAGCCACCACTCACCCTACTCCAGGCATTCGGCAATGTG
PFKFB1AGAAGGGGCTCATCCATACCCCTCTCGTCGATACTGGCCTAA
PFKFB2TGGGCCTCCTACATGACCAACAGTTGAGGTAGCGTGTTAGTTT
PFKFB3TTGGCGTCCCCACAAAAGTAGTTGTAGGAGCTGTACTGCTT
PFKFB4TCCCCACGGGAATTGACACGGGCACACCAATCCAGTTCA
LDH-AATGGCAACTCTAAAGGATCAGCCCAACCCCAACAACTGTAATCT
LDH-BTGGTATGGCGTGTGCTATCAGTTGGCGGTCACAGAATAATCTTT
LDH-CAGAACATGGTGATTCTAGTGTGCACAGTCCAATAGCCCAAGAGG
HIF-1αGAACGTCGAAAAGAAAAGTCTCGCCTTATCAAGATGCGAACTCACA
AMPK-α1TTGAAACCTGAAAATGTCCTGCTGGTGAGCCACAACTTGTTCTT
AMPK-α2GTGAAGATCGGACACTACGTGCTGCCACTTTATGGCCTGTTA
AMPK-β1CCACTCCGAGGAAATCAAGGCCTGGGCGGGAGCTTTATCA
GLUT1GGCCAAGAGTGTGCTAAAGAAACAGCGTTGATGCCAGACAG
β-actinCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT
PGC1TCTGAGTCTGTATGGAGTGACATCCAAGTCGTTCACATCTAGTTCA
PPRC1CAAGCGCCGTATGGGACTTTGGAGGCATCCATGTAGCTCT
PPAR-αATGGTGGACACGGAAAGCCCGATGGATTGCGAAATCTCTTGG
PPAR-γGGGATCAGCTCCGTGGATCTTGCACTTTGGTACTCTTGAAGTT