Skip to main content

Table 1 The primer sequences for relative mRNA used in this study

From: Pin2 telomeric repeat factor 1-interacting telomerase inhibitor 1 (PinX1) inhibits nasopharyngeal cancer cell stemness: implication for cancer progression and therapeutic targeting

IDSequence (5′-3′)Product Length(bp)
PinX1 FCCAGAGGAGAACGAAACCACG128
PinX1 RACCTGCGTCTCAGAAATGTCA
E-cadherin FACAGGGAGGATTTTGAGCAC107
E-cadherin RGATCAGCAGAAGTGTCCCTG
Vimentin FAGTCCACTGAGTACCGGAGAC98
Vimentin RCATTTCACGCATCTGGCGTTC
Snail1 FACTGCAACAAGGAATACCTCAG242
Snail1 RGCACTGGTACTTCTTGACATCTG
Twist1 FGAGCAAGATTCAGACCCTCA115
Twist1 RCTCGTGAGCCACATAGCTG
Zeb1 FCAGCTTGATACCTGTGAATGGG106
Zeb1 RTATCTGTGGTCGTGTGGGACT
GAPDH FTGTTCGTCATGGGTGTGAAC154
GAPDH RATGGCATGGACTGTGGTCAT