Skip to main content

Table 1 Gene primers

From: ALG3 contributes to stemness and radioresistance through regulating glycosylation of TGF-β receptor II in breast cancer

Gene Name Forward primer Reverse primer
ALG3 5′CACCGTTAAGATGGCGGCT3′ 5′CCATTGCTTGCAGAGTCCCT3′
ALG1 5′CATGTAGTAGCGGTGGTGCT3′ 5′GCCCAACTGCAAGACTCTGA3′
ALG2 5′GTACATGGCTCCCCATTGGT3′ 5′TTGGGGCCCTGTATAGTCGT3′
ALG6 5′ATCTTGTGACTGCGACCTCC3′ 5′GGCAAGGCGTGGTAAAGTTC3′
ALG8 5′CCCCACATACCATTCCACAGA3′ 5′CGTCCACTCTGAAGTTGCCT3′
ALG9 5′CGACTTCATAGGGTGCCGAA3′ 5′CCAGATAACTCGGTCCGGTG3′
ALG10 5′TTCCAGGAGTAGGTTCTTGGGC3′ 5′GGCCGAGAAATAGTAACCTTCCA3′
ALG11 5′ GTGCCTGTGCAAGTTGTTGAG3′ 5′GTAGCAGCAGTCTGATTCCCC3′
ALG12 5′ GGCCCTGTATGTGTCCCATT3′ 5′GCACATCCTCCCTCTTGTCG3′
ALG13 5′TGTTACCGTAGGGACCACCA3′ 5′TCAGGTACCACCGTTCCTCT3′
FOXD1 5′TTCTCGTCTTGGTGGTTCGG3′ 5′CAAACGTCAAGGGAGCCTCT3′
SPHK1 5′GAGCGAAAAGTTTGAGGCCG3′ 5′GTTCCCTACAGTGGCCTGG3′
CHST11 5′ATGCGGAGGAATCCCTTTGG3′ 5′GGTCCTCATCCACCACCAAG3′
EST2 5′CAAGCTGTTTGCGGGGATTC3′ 5′TCCGGGCATAGCTGAGGAAG3′
PIK3CD 5′CATTCCTCCTCCATCCTCGC3′ 5′AGCTCCTCCTCGGTGACAT3′
TBX3 5′ACTTCCTGCACCAACACCAA3′ 5′CCTCCCCACAGCAATCTCAG3′
PPARD 5′GCACCAACGAGGGTCTGGAA3′ 5′CGGATCGTACGACGGAAGAA3′
BHLHE40 5′TGGAGCCTTCCTGAAGGTGTAA3′ 5′GGACATGGGAGTCAGCCATA3′
GAPDH 5′TTGAGGTCAATGAAGGGGTC3′ 5′GAAGGTGAAGGTCGGAGTCA3′