Skip to main content

Table 1 Primers used for SSTRs, opioid receptors and β-actin amplification by PCR

From: Somatostatin and opioid receptors do not regulate proliferation or apoptosis of the human multiple myeloma U266 cells

Gene name Primers Cycles Denaturation step Elongation step Anneling step
β-actin F – 5'ATGGATGATGATATCGCCGCG3'
R-5'TCCAGACGCAGGATGGCATGG3'
35 1 min at 95°C 1 min at 72°C 1 min at 60°C
SSTR1 F-5'AGCCGGTTGACTATTACGCC3'
R-5'GCTCTCACTTCTACCATTGTC3'
45 1 min at 95°C 2 min at 72°C 1 min at 60°C
SSTR2 F-5'GGTGAAGTCCTCTGGAATCC3'
R-5'CCATTGCCAGTAGACAGAGC3'
45 30 sec at 95°C 2 min at 72°C 1 min at 63°C
SSTR3 F-5'TCATCTGCCTCTGCTACCTG3'
R-5'GAGCCCAAAGAAGGCAGGCT3'
45 30 sec at 95°C 2 min at 72°C 1 min at 65°C
SSTR4 F-5'CACCAGCGTCTTCTTCTCA3'
R-5'ATGGGGAGAGTGACCAACAG3'
35 1 min at 95°C 1 min at 72°C 1 min at 55°C
SSTR5 F-5'TCATCTGCCTGTGCTACCTG3'
R-5'GGAGAGGATGACCACGAAGA3'
35 1 min at 95°C 1 min at 72°C 1 min at 55°C
MOP-R F-5'CAATGCAGAAGTGCCAAGAA3'
R-5'CAAGATGAAGACTGCCACCA3'
45 30 sec at 95°C 1 min at 72°C 1 min at 56°C
KOP-R F-5'AAGGAGCACTCAATGAC3'
R-5'CAGCATCTTCACCTTGACCA3'
35 1 min at 94°C 1 min at 72°C 1 min at 55°C
DOP-R F-5'GGACGCTGGTGGACATC3'
R-5'GGATCCCGTCTCCGAAACA3'
40 30 sec at 96°C 1 min at 72°C 30 sec at 58°C
  1. Primers (F, forward and R, reverse) used for amplification of SSTRs, opioid receptors and β-actin genes and PCR conditions are indicated.