Skip to main content

Advertisement

Table 1 Primer sequences

From: An embryo-specific expressing TGF-β family protein, growth-differentiation factor 3 (GDF3), augments progression of B16 melanoma

Primer name Primer sequence (F: forward) Primer sequence (R: reverse)
Dppa2 agaagccgtgcaaagaaaaa gttaaaatgcaacgggctgt
Fthl17 actttgggactgtgggactg ttgatagcatcctcgcactg
Sall4 gcccctcaactgtctctctg gggagctgttttctccactg
Rex1 caggttctggaagcgagttc gacaagcatgtgcttcctca
Utf1 ttacgagcaccgacactctg cgaaggaacctcgtagatgc
Tcl1 caccatgagggacaagacct cttacaccgctctgcaatca
Sox2 atgggctctgtggtcaagtc ccctcccaattcccttgtat
Dppa3 ctttgttgtcggtgctgaaa tcccgttcaaactcatttcc
Gdf3 acctttccaagatggctcct cctgaaccacagacagagca
Ecat8 tgtgtactggcaaccaaaa ctgaggtcccatcagctctc
Dnmt3l caagcctcgtgactttcctc ccatggcattgatcctctct
Eras atcctaacccccaactgtcc caagcctcgtgactttcctc
Fbxol5 ctatgattggctgcgacaga gtagtgtcgggaggcaatgt
Dppa5 cagtcgctggtgctgaaata tccatttagcccgaatcttg
Ecatl gaatgcctggaagatccaaa aaatctcagctcgcctttca
Dppa4 agggctttcccagaacaaat gcaggtatctgctcctctgg
Soxl5 cggcgtaagagcaaaaactc tgggatcactctgagggaag
Oct3/4 ccaatcagcttgggctagag ctgggaaaggtgtccctgta
Nanog cacccacccatgctagtctt accctcaaactcctggtcct
c-Myc gcccagtgaggatatcttgga atcgcagatgaagctctggt
Grb2 tcaatgggaaagatggcttc gagcatttcttctgccttgg
β-catenin gtgcaattcctgagctgaca cttaaagatggccagcaagc
Stat3 agactacaggccctcagcaa cctctgtcaggaaaggcttg
CD133 ctcatgcttgagagatcaggc cgttgaggaagatgtgcacc
CD24 actctcacttgaaattgggc gcacatgttaattactagtaaagg
CD44 gaaaggcatcttatggatgtgc ctgtagtgaaacacaacacc
ABCB5 gtggctgaagaagccttgtc tgaagccgtagccctcttta
GDF3 aaatgtttgtgttgcggtca tctggcacaggtgtcttcag