Skip to main content

Table 1 PCR primers of human TLRs

From: Reduced expression of Toll-like receptor 4 inhibits human breast cancer cells proliferation and inflammatory cytokines secretion

Genes Primer sequence (5'-3') Amplification size (bp)
TLR1 For: TCTGGTACACGCATGGTC 517 bp
  Rev: ATGGGTGGGAAACTGAAT  
TLR2 For: AACTTACTGGGAAATCCTTAC 264 bp
  Rev: AAAAATCTCCAGCAGTAAAAT  
TLR3 For: GCATTTGTTTTCTCACTCTTT 131 bp
  Rev: TTAGCCACTGAAAAGAAAAAT  
TLR4 For: CGAGGAAGAGAAGACACCAGT 106 bp
  Rev: CATCATCCTCACTGCTTCTGT  
TLR5 For: AGCTTCAACTATATCAGGACA 383 bp
  Rev: TGGTTGGAGGAAAAATCTAT  
TLR6 For: CTTCCATTTTGTTTGCCTTAT 123 bp
  Rev: AGCGGTAGGTCTTTTGGAAC  
TLR7 For: AAACTCCTTGGGGCTAGATG 149 bp
  Rev: AGGGTGAGGTTCGTGGTGTT  
TLR8 For: CTGTGAGTTATGCGCCGAAGA 246 bp
  Rev: TGGTGCTGTACATTGGGGTTG  
TLR9 For: CGCCCTGCACCCGCTGTCTCT 168 bp
  Rev: CGGGGTGCTGCCATGGAGAAG  
TLR10 For: AGAAGAAAGGGAACTGATGAC 279 bp
  Rev: CCTGCCAGTAAATACCAAGT  
GAPDH For: GGATTTGGTCGTATTGGG 205 bp
  Rev: GGAAGATGGTGATGGGATT