Skip to main content

Table 1 Primer sequences for quantitative real time-polymerase chain reaction

From: EZH2 is increased in paediatric T-cell acute lymphoblastic leukemia and is a suitable molecular target in combination treatment approaches

Gene Sense Antisense
EZH2 5′cgcttttctgtaggcgatgt 3′ 5′tgggtgttgcatgaaaagaa 3′
SUZ12 5′gggagactattcttgatgggaag 3′ 5′actgcaacgtaggtccctga 3′
EED 5′gaaattccatccaagagatcca 3′ 5′tggatattccataatcgtaaagca3′
β-actin 5′gcgagaagatgacccagatc 3′ 5′ggatagcacagcctggatag 3′