Skip to main content

Table 1 The primer sequences used in this study

From: CCR7 mediates the TNF-α-induced lymphatic metastasis of gallbladder cancer through the “ERK1/2 - AP-1” and “JNK - AP-1” pathways

Oligonucleotides Sequences (5′ → 3′)a Length of products (bp)
CCR7 promoter cloning   
 −1055/+74F ccg CTCGAG CAGCCCAAACATCCAACT 1129
 −725/+74F ccg CTCGAG GTGATGGTTGCATAACTCTG 799
 −462/+74F ccg CTCGAG GGAAAGCCATTTGGGACT 536
 −243/+74F ccg CTCGAG GGATCCTATGACCAGCGAC 317
 −108/+74F ccg CTCGAG TGGCTTCTCCGACAACTT 182
 −1055/+74R ccc AAGCTT CAGGGTCAGTCTGGGTGT  
Site-directed mutagenesis   
 AP1mut1F CTGTCACCCTCTGGCACCTTTCTTCTG  
 AP1mut1R CAGAAGAAAGGTGCCAGAGGGTGACAG  
 AP1mut2F CCTGCATGAGTTCAGGAGGGCTGGG  
 AP1mut2R CCCAGCCCTCCTGAACTCATGCAGG  
PCR for ChIP   
 AP1 ChIP-F CACCTTTCTTCTGCCCCTTTATC 134
 AP1 ChIP-R TCAAGCCCCTTTTAAGTTGTCGG
  1. aLowercase letters represent the protective-bases; italic letters represent the restriction enzyme cutting site; underlined letters represent the bases of mutation