Skip to main content

Table 1 The primer sequences of Chemokines used in this article

From: EphA1 activation promotes the homing of endothelial progenitor cells to hepatocellular carcinoma for tumor neovascularization through the SDF-1/CXCR4 signaling pathway

Target gene Forward sequence Reverse sequence
CXCL1 CATCGAAAAGATGCTGAACAGT ATAAGGGCAGGGCCTCCT
CXCL5 CCTTTTCTAAAGAAAGTCATCCAGA TGGGTTCAGAGACCTCCAGA
CXCL9 CTGGAGCAGTGTGGAGTTC CCGTTCTTCAGTGTAGCAATG
CXCL10 GAACTGTACGCTGTACCTGCA TTGATGGCCTTCGATTCTGGA
CXCL11 CAGAGAGGCTGAGACCAACC GCTGAAGGTGTGAGCTTTGG
CXCL12 CTCGGGATGTGTAATGGCT GCCTCCATGGCATACATAGA
CXCLl16 ACTCGTCCCAATGAAACCAC ATGAAGATGATGGCCAGGAG
CCL2/MCP-1 GCATCCACGTGTTGGCTCA CTCCAGCCTACTCATTGGGATCA
CCL20 GCCTCTCGTACATACAGACGC CCAGTTCTGCTTTGGATCAGC
CCL22/MDC TGCGCGTGGTGAAACACTT TAGGCTCTTCATTGGCTCAGCT