Skip to main content

Table 1 Primers for PCR assay

From: DNA methylation of claudin-6 promotes breast cancer cell migration and invasion by recruiting MeCP2 and deacetylating H3Ac and H4Ac

Gene name Sequence (5’ → 3’)
Reverse transcription PCR primers  
 CLDN6  
  Sense CACTGCCACTTCTGGATGG
  Antisense CAGTGCAGCTCCTTCAACCT
 β-actin  
  Sense CCACTGCGTCGCGGGG
  Antisense GGCAGCCAGCTCAGCCATG
 GAPDH  
  Sense TGTTGCCATCAATGACCCCTT
  Antisense CTCCACGACGTACTCAGCG
Methylation-Specific PCR primers  
 Unmethylated DNA  
  Sense TGGATGTTTGTTAGTTTGAGGT
  Antisense ATAACCACAACCCAAATTCACA
 Methylated DNA  
  Sense ACGTTTGTTAGTTCGAGGC
  Antisense ATAACCGCAACCCGAATTC
ChIP primers  
 CLDN6  
  Sense CCCATCCCCACGCACGCTT
  Antisense GCCACCTGGATGGGCGAGTC
Nuclease Accessibility primers  
 Primer1  
  Sense TCTCCCCAAGGTGGTCTGCT
  Antisense CCTTTTCAAATCCAGGTTCGGC
 Primer2  
  Sense GGCGGTGGTCCAGTGACGT
  Antisense TAAAGGGAATAG AGGAAGCGTCC
 Primer3  
  Sense AGTCTCCCCAAGGTGGTCTGC
  Antisense CCTTTTCAAATCCAGGTTCGGC
 Primer4  
  Sense AGGAATTTCCCTTATCTCCTTCGC
  Antisense CCCATCCCCACGCACGCTT
 Primer5  
  Sense GCCACCTGGATGGGCGAGTC
  Antisense GAGGGTTCCCAATTTGCGGG
 Primer6  
  Sense CAGGGACAA AGACTCCGAAACC
  Antisense CTGGAACGCCGGTGACGT
 Primer7  
  Sense CTCCCCAAGGTGGTCTGCT
  Antisense TCAAATCCAGGTTCGGCATGTTA
 Primer8  
  Sense CCACTGCAGCTATAGAACCCCTCCA
  Antisense TTCTTTCCCCGTCCCCG