Skip to main content

Table 1 List of primers used for candidate genes

From: Exosomes play an important role in the process of psoralen reverse multidrug resistance of breast cancer

Gene name Forward primer (5'to 3') Reverse primer (5'to 3') prodSize Tm (°C)
KRTAP2-3 CTCCACCTTGTCCTCCCTGA GGCAGGGCTCGCAGATG 155 61
FOSL1 GAAGGCCTTGTGAACAGGAG CTTCCAGCACCAGCTCTAGG 111 60
MMP1 CCAAGGTCTCTGAGGGTCAA CTGGTTGAAAAGCATGAGCA 114 60
MYPN AATGAGACCATCCCTTGCAC TGGCTGACAACGTGTACCAT 121 60
ENSG00000231826.1 CCAGCTTTGTCCTGACCTTC GTTGCTGCCAAACTGCTACA 121 60
ALPP AGAATCTGGTGCAGGAATGG AGGCTCAAAGAGACCCATGA 122 60
ENSG00000237862.1 CATGGCCTCCTGATGAAGAT AAGCAGGTTGGAAGTCAGGA 119 60
LRRC15 TCGACCACCTGGTAGGACTC TTCTCATACAGCCGGAGGAC 115 60
TMEM40 AGATGGGAAGGCTGGACTCT TTGCTCTCTGAGGAGGAGGA 120 60
ALPL GACAAGAAGCCCTTCACTGC AGACTGCGCCTGGTAGTTGT 120 60
TMEM200A GCTATGGCCGTTCTTGGATA AAAGAAGCGAACCACCACAC 120 60
LCE2A CAGCAAAACCAGCAGCAGT CCACAGCAGGAAGAGACTGG 125 61
SIRPB1 CTGTGCTATGACGTCCCTGA GTTGTTACCCGTGGGAAGTG 114 60
SESN3 ATGCTTTGGCAAGCTTTGTT GCAAGATCACAAACGCAGAA 112 60
PEAR1 CCTGATCCATGACCGAGACT CCGTACTGGAGGCAAGTCAT 124 60
HSD17B6 TCTGGGGACTGGTGAACAAT AAGGTCACCTGGATCACACC 121 60
ENSG00000261159.1 GGCTGCATTTTGTCCTGTCT TGACTGTGCTGACCAAGAGC 127 60
INHBA AGACGCTGCACTTCGAGATT GGATGGTGACTTTGGTCCTG 120 60
ARNT2 GGATGAGGTGTGGAAATGCT ACCACAGCATATTGGGCTTC 121 60
IGFN1 GGGTCAGAACAGCCTATGGA CATCTGCTGATCCCATTCCT 120 60
RXFP4 TGCCTGTCAAATTCCTAGCC CTCTCCGGGCACAGTTACTC 120 60
  1. The table displays the List of primers used for candidate genes after psoralen treatment. It holds the primers sequences, production size and the annealing temperature (Tm)