Skip to main content

Table 1 Relative sequences in this study

From: Synthetic regulatory RNAs selectively suppress the progression of bladder cancer

Name Relative sequence (5′-3′)
NC amiRNA CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCATTCTCCGAACGTGTCACGTATAGTG
AAGCCACAGATGTATACGTGACACGTTCGGAGAATTTGCCTACTGCCTCGCTTCAAGGTA
TATTGCTGTTGACAGTGAGCGCATTCTCCGAACGTGTCACGTATAGTGAAGCCACAGATG
TATACGTGACACGTTCGGAGAATTTGCCTACTGCCTCGGCGGCCGC
MYC amiRNA CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCACAGAAATGTCCTGAGCAATATAGTG
AAGCCACAGATGTATATTGCTCAGGACATTTCTGTTTGCCTACTGCCTCGCTTCCTTCCTTC
AAGGTATATTGCTGTTGACAGTGAGCGCATGGACAGTGTCAGAGTCTATAGTGAAGCCAC
AGATGTATAGACTCTGACACTGTCCATTTGCCTACTGCCTCGGCGGCCGC
iRNA GAAUUCCGGAGGUCAGAACUCUUGG
aRNA CGCCAAGAGUUCUGUCCUCCGGUGGUGGUUAAUGAAAAUUAACUUACUAUACCAUAUA
UCUCUAGA
mutant
hTERT promoter
GGCCCCTCCCTCGGGTTACCCCACAGCCTAGGCCGATTCGACCTCTCTCCGCTGGGGCC
CTCGCTGGCGTCCCTGCACCCTGGGAGCGCGAGCGGCGCGCGGGCGGGGAAGCGCGG
CCCAGACCCCCGGGTCCGCCCGGAGCAGCTGCGCTGTCGGGGCCAGGCCGGGCTCCCA
GTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGG
GACCCGGGCACCCGTCCTGCCCCTTCACCTTCCGGCTCCGCCTCCTCCGCGCGGACCCCG
CCCCGTCCCGACCCCTTCCGGGTTTCCGGCCCAGCCCCTTCCGGGCCCTCCCAGCCCCTC
CCCTTCCTTTCCGGGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCCGGCAGCGCTGCGTC
CTGCTGCGCACGTGGGAAGCCCTGGCCC CGGCCACCCCCGCG
UAS CGGAGTACTGTCCTCCG
GAL4-VP64 ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAG
TGCT CCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCT
ACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCA
AGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATG
ATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGA
TAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTA
ACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGT
CAAAGACAGTTGACTGTATCGGGTTCCGGACGGGCTGACGCATTGGACGATTTTGATCTG
GATATGCTGGGAAGTGACGCCCTCGATGATTTTGACCTTGACATGCTTGGTTCGGATGCCC
TTGATGACTTTGACCTCGACATGCTCGGCAGTGACGCCCTTGATGATTTCGACCTGGACAT
GCTGATTAAC
si-MYC sense
si-MYC antisense
GCUUCACCAACAGGAACUATT
UAGUUCCUGUUGGUGAAGCTT