Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Long non-coding RNA LINC00968 attenuates drug resistance of breast cancer cells through inhibiting the Wnt2/β-catenin signaling pathway by regulating WNT2

Gene Sequence (5′-3′)
LINC00968 F: GGGTAACTTCAGGTGGAGCC
R: ACACGAAAGGCTGGAAGTGT
WNT2 F: GATGCGTGCCATTAGCCAG
R: AGATTCCCGACTACTTCGGAG
β-catenin F: CGTGGACAATGGCTACTCAAGC
R: TCTGAGCTCGAGTCATTGCATAC
Vimentin F: GACAATGCGTCTCTGGCACGTCTT
R: TCCTCCGCCTCCTGCAGGTTCTT
E-cadherin F: CCCACCACGTACAAGGGTC
R: CTGGGGTATTGGG GGCATC
GAPDH F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
  1. Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, F forward, R reverse, LINC00968 long non-coding RNA LINC00968, WNT2 Wingless-type MMTV integration site family member 2, GAPDH glyceraldehyde 3-phosphate dehydrogenase