Skip to main content

Advertisement

Table 2 Primers used for qPCR

From: PKM2 is the target of proanthocyanidin B2 during the inhibition of hepatocellular carcinoma

Gene name Forward (5′-3′) Reverse (5′-3′)
HSP90AA1 AGGAGGTTGAGACGTTCGC AGAGTTCGATCTTGTTTGTTCGG
HSP90AB1 AGAAATTGCCCAACTCATGTCC ATCAACTCCCGAAGGAAAATCTC
PKM2 ATGTCGAAGCCCCATAGTGAA TGGGTGGTGAATCAATGTCCA
HK2 GAGCCACCACTCACCCTACT CCAGGCATTCGGCAATGTG
PFKFB1 AGAAGGGGCTCATCCATACCC CTCTCGTCGATACTGGCCTAA
PFKFB2 TGGGCCTCCTACATGACCAA CAGTTGAGGTAGCGTGTTAGTTT
PFKFB3 TTGGCGTCCCCACAAAAGT AGTTGTAGGAGCTGTACTGCTT
PFKFB4 TCCCCACGGGAATTGACAC GGGCACACCAATCCAGTTCA
LDH-A ATGGCAACTCTAAAGGATCAGC CCAACCCCAACAACTGTAATCT
LDH-B TGGTATGGCGTGTGCTATCAG TTGGCGGTCACAGAATAATCTTT
LDH-C AGAACATGGTGATTCTAGTGTGC ACAGTCCAATAGCCCAAGAGG
HIF-1α GAACGTCGAAAAGAAAAGTCTCG CCTTATCAAGATGCGAACTCACA
AMPK-α1 TTGAAACCTGAAAATGTCCTGCT GGTGAGCCACAACTTGTTCTT
AMPK-α2 GTGAAGATCGGACACTACGTG CTGCCACTTTATGGCCTGTTA
AMPK-β1 CCACTCCGAGGAAATCAAGGC CTGGGCGGGAGCTTTATCA
GLUT1 GGCCAAGAGTGTGCTAAAGAA ACAGCGTTGATGCCAGACAG
β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT