Skip to main content

Table 1 Sequence if PCR Primers Used in This Study

From: The transcription factor LEF1 promotes tumorigenicity and activates the TGF-β signaling pathway in esophageal squamous cell carcinoma

Gene Forward primer sequence (5’ −> 3’) Reverse primer sequence (5’ −> 3’)
CD133 GCCACCGCTCTAGATACTGC TGTTGTGATGGGCTTGTCAT
CD44 GAGCATCGGATTTGAGA CATACTGGGAGGTGTTGG
ABCG2 CAGGTTACGTGGTACAAGATGA GATCAGTGATAAGCTCCATTCC
KLF4 CCATTACCAAGAGCTCATGC GTGCCTGGTCAGTTCATCTG
SOX2 CAAGATGCACAACTCGGAGA GCTTAGCCTCGTCGATGAAC
NANOG CTGCTGGACTGAGCTGGTTGCC GCTGAGGCCTTCTGCGTCACA
OCT4 AGTGAGAGGCAACCTGGAGA ACACTCGGACCACATCCTTC
EPCAM AATCGTCAATGCCAGTGTACTT TCTCATCGCAGTCAGGATCATAA
CXCR4 ACTACACCGAGGAAATGGGCT CCCACAATGCCAGTTAAGAAGA
LEF1 AGAACACCCCGATGACGGA GGCATCATTATGTACCCGGAAT
COMP GATCACGTTCCTGAAAAACACG GCTCTCCGTCTGGATGCAG
BMP8A AGAAAAGCAACGAGCTGCCG GCCGCGGACGTCATCAAA
ID1 CTGCTCTACGACATGAACGG GAAGGTCCCTGATGTAGTCGAT
ID3 GAGAGGCACTCAGCTTAGCC TCCTTTTGTCGTTGGAGATGAC
SMAD9 CTAGGCTGGAAGCAAGGAGAT GGGGAATCGTGACGCATTT
CHRD TTCGGCGGGAAGGTCTATG ACTCTGGTTTGATGTTCTTGCAG
DCN ATGAAGGCCACTATCATCCTCC GTCGCGGTCATCAGGAACTT