Skip to main content

Table 1 Primer sequences in this paper

From: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

NamesequencesPrimer Length (bp)
YB1-S102A-ForwardCCCCAGGAAGTACCTTCGCGCTGTAGGAGATGGAGAGACTGTGGAGT47
YB1-S102A-ReverseACTCCACAGTCTCTCCATCTCCTACAGCGCGAAGGTACTTCCTGGGG47
E-cadherin- ForwardTGCCCAGAAAATGAAAAAGG20
E-cadherin -ReverseGTGTATGTGGCAATGCGTTC20
vimentin- ForwardCCTGAACCTGAGGGAAACTAA21
vimentin-ReverseGCAGAAAGGCACTTGAAAGC20
Snail1- ForwardTGCGTCTGCGGAACCTG17
Snail1-ReverseGGACTCTTGGTGCTTGTGGA20
Claudin1-ForwardCTGTCATTGGGGGTGCGATA20
Claudin1-ReverseCTGGCATTGACTGGGGTCAT20
BRD7-ForwardAAGCACACGCCTTCAAGAGT20
BRD7- ReverseTTCCTTCACGATGCGGTCAA20
YB1-ForwardAAGGAGAAAAGGGTGCGGAG20
YB1-ReverseCCTACGACGTGGATAGCGTC20
GAPDH-ForwardCAACGGATTTGGTCGTATTGG21
GAPDH-ReverseTGACGGTGCCATGGAATT19