Skip to main content

Table 1 Primer sequences in this paper

From: BRD7 suppresses invasion and metastasis in breast cancer by negatively regulating YB1-induced epithelial-mesenchymal transition

Name sequences Primer Length (bp)
YB1-S102A-Forward CCCCAGGAAGTACCTTCGCGCTGTAGGAGATGGAGAGACTGTGGAGT 47
YB1-S102A-Reverse ACTCCACAGTCTCTCCATCTCCTACAGCGCGAAGGTACTTCCTGGGG 47
E-cadherin- Forward TGCCCAGAAAATGAAAAAGG 20
E-cadherin -Reverse GTGTATGTGGCAATGCGTTC 20
vimentin- Forward CCTGAACCTGAGGGAAACTAA 21
vimentin-Reverse GCAGAAAGGCACTTGAAAGC 20
Snail1- Forward TGCGTCTGCGGAACCTG 17
Snail1-Reverse GGACTCTTGGTGCTTGTGGA 20
Claudin1-Forward CTGTCATTGGGGGTGCGATA 20
Claudin1-Reverse CTGGCATTGACTGGGGTCAT 20
BRD7-Forward AAGCACACGCCTTCAAGAGT 20
BRD7- Reverse TTCCTTCACGATGCGGTCAA 20
YB1-Forward AAGGAGAAAAGGGTGCGGAG 20
YB1-Reverse CCTACGACGTGGATAGCGTC 20
GAPDH-Forward CAACGGATTTGGTCGTATTGG 21
GAPDH-Reverse TGACGGTGCCATGGAATT 19