Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Exosome-mediated transfer of miR-93-5p from cancer-associated fibroblasts confer radioresistance in colorectal cancer cells by downregulating FOXA1 and upregulating TGFB3

RNAForward (5′-3′)Reverse (5′-3′)
miR-93-5pGCAGCAAACTTCTGAGACACGTGCAGGGTCCGAGGTATTC
FOXA1GCAATACTCGCCTTACGGGCTTACACACCTTGGTAGTACGCC
TGFB3ATGCCAAAGAAATCCATAAATTCGAAGCGGAAAACCTTGGAGGTA
TGF-β1CACCATCCATGACATGAACCTCATGTTGGACAACTGCTCC
Smad3ACGCAGAACGTGAACACCAAGCTGTGAAGCGTGGAATGTC
GAPDHACAACCTTTGGTATCGTGGAAGGGCCATCACGCCACAGTTTC