Skip to main content

Table 1 Primer sequences for RT-qPCR

From: NF-κB maintains the stemness of colon cancer cells by downregulating miR-195-5p/497–5p and upregulating MCM2

RNA Primer sequences (5′-3′)
miR-195-5p Forward: ACACTCCAGCTGGGTAGCAGCACAGAAAT
Reverse: TGGTGTCGTGGAGTCG
miR-497-5p Forward: CAGCAGCACTGTGGTTTGT
Reverse: CGACAGCAGCACACTGTGGTT
MCM2 Forward: CCTCTGTGCTTTATGGACAC
Reverse: GGAGGCTCACGAAACAGAGG
U6 Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCTTC
GAPDH Forward: TCAAGGCTGAGAACGGGAAG
Reverse: TGGACTCCACGACGTACTCA-3