Skip to main content

Table 1 Primers used for qRT-PCR

From: Progranulin induces immune escape in breast cancer via up-regulating PD-L1 expression on tumor-associated macrophages (TAMs) and promoting CD8+ T cell exclusion

Gene name Forward (5′-3′) Reverse (5′-3′)
PGRN TACACCACGGATCTCCTGACCAAG CAGTGTTGAGGCGGCAGCAG
IL-12 ACCAGAGCAGTGAGGTCTTAGGC TGTGAAGCAGCAGGAGCGAATG
TNFα GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG
Arg1 CATTGGCTTGCGAGACGTAGAC GCTGAAGGTCTCTTCCATCACC
IL-10 CGGGAAGACAATAACTGCACCC CGGTTAGCAGTATGTTGTCCAGC
PD-L1 AAGCCTCAGCACAGCAACTTCAG TGTAGTCCGCACCACCGTAGC
β-actin CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG
\