Skip to main content

Table 1 The site mutant primers of TYK2

From: Cirsiliol targets tyrosine kinase 2 to inhibit esophageal squamous cell carcinoma growth in vitro and in vivo

Name Forward primer (5′ to 3′) Revers primer (5′ to 3′)
1A CTGGTCATGGAGTACGCGCCCCTGGGCA GCGTACTCCATGACCAGCTGCAGCGACT
1’A GGTCATGGAGTACGTGGCCCTGGGCAGC CCACGTACTCCATGACCAGCTGCAGCGA
2A GGTCATGGAGTACGCGGCCCTGGGCAGC CCGCGTACTCCATGACCAGCTGCAGCGA
  1. 1A (Val 981 to Ala); 1’A (Pro 982 to Ala); 2A (double mutant to Ala)