Patients and samples
Eighty-six patients with HCC presenting at Tangdu and Xijing Hospital of FMMU between 1999 and 2006, for whom sufficient paraffin embedded tissue was available, were enrolled in the present investigation. All the patients were not given the adjuvant radio- and/or chemo-therapy before the resection. Of the patients, seventy were male and sixteen were female with median age 65 years (range 31 to 76). The mean size of tumor was 5.5 ± 2.1 cm (mean ± SD) in diameter with a range from 2.5 to 11.0 cm(For the patient with multiple focus, the dimension of the largest tumor was recorded). Tumor staging was in accordance to the AJCC staging system. 27 cases of hepatic cirrhosis, eighteen cases of hepatic hemangiomas, and twelve cases of normal hepatic tissues were used as the control.
All tissues were scored by two pathologists blinded to disease status. Grading of HCC was based on Edmondson methods [15]. Histopathologic findings of eighty-six HCC samples were divided into four grades according to Edmondson standard, including 18 Grade I, 25 Grade II, 21 Grade III, 22 Grade IV. By the time this study was undertaken, ten patients with HCC had been lost to follow-up or died without known tumor recurrence, and seven patients were excluded who were given post-operative chemotherapy. During the follow-up period, the recurrence-free survival time for the remaining sixty-nine patients was 15.5 months (range 5 to 53 months).
Immunohistochemical analysis of tissue c-FLIP expression
Sections (4 μm) were deparaffinized, rehydrated, immersed in 3% H2O2 for 10 min and microwaved at 750 W in citrate buffer (pH 6.0) for 15 min. Tissue sections were then blocked for 20 min with normal rabbit serum and incubated overnight at 4°C with rabbit anti-human c-FLIP polyclonal antibodies, diluted 1:200(Abcan, UK). Incubation with PBS instead of the primary antibody served as a negative control. After washing twice with PBS for 2 min each, immunostaining was performed using the standard S-P technique (Beijing Zhongshan Bio., China) and visualized with diaminobenzidine tetrahydrochloride solution.
Staining was assessed blindly by one observer. A minimum of five randomly selected fields (200×) were examined, with a mean of 1500 cells counted throughout the whole section. The labeling index was defined as the percentage of neoplastic cells with clear cytoplasmic immunoreactivity of the total number of neoplastic cells counted. The threshold for c-FLIP positivity was 10%. The intensity of staining was scored as 0: achromatic, 1: light yellow, 2: yellow, 3: brown.
Construction of RNAi vectors
According the sequence of the c-FLIP mRNA, the siRNA oligonucleotides were designed and synthesized to the targeted RNAi regions at 526~544, 1164~1182, 1305~1323 nt. Bgl II and Hind III sites were respectively generated at the 5' and 3' ends of the templates (as shown below). si-526:
5'-CCCGGAGCAGGGACAAGTTACA TTCAAGAGATGTAACTTGTCCCTGCTCC TTTTTGGAAA-3' (Forward);
5'-TTTCCAAAAAGGAGCAGGGACAAGTTACA TCTCTTGAATGTAACTTGTCCCTGCTCC GGG-3' (Back).
si-1164:
5'-CCCGCGAGGGCTGTGCACAGTT TTCAAGAGAAACTGTGCACAGCCCTCGC TTTTTGGAAA-3' (Forward);
5'-TTTCCAAAAAGCGAGGGCTGTGCACAGTT TCTCTTGAAAACTGTGCACAGCCCTCGC GGG-3' (Back).
si-1305:
5'-CCCACGCCCACTCCTGGATCTT TTCAAGAGAAAGATCCAGGAGTGGGCGT TTTTTGGAAA-3' (Forward);
5'-TTTCCAAAAAACGCCCACTCCTGGATCTT TCTCTTGAAAAGATCCAGGAGTGGGCGT GGG-3' (Back).
These above siRNA-encoding complementary single-stranded oligonucleotides were hybridized to give Bgl II- and Hind III-compatible overhangs, and then ligated into pSuper (linked overnight at 16°C). After E. Coli, DH5α, transfected by the recombinant vectors, the positive clones were selected. With positive plasmids, the sequences were checked by sequencing a PCR-amplified region containing the oligonucleotides. The recombinant plasmids were named as pSuper-Si1, pSuper-Si2, pSuper-Si3 and pSuper-Neg(no target segment inserted), respectively.
siRNA transfections
HCC cell line, 7721, showed stronger staining intensity (results not shown), and was used as the target cell for the following study. 7721 cells were cultured in RPMI1640(Invitrogen, USA) containing 10% fetal bovine serum(FBS), and maintained in a humidified 37°C incubator with 5% CO2 by routine passage every 3 days or as needed.
Plasmids were transfected into cells according to the manufacturer's protocol of LipofectamineTM 2000 (Invitrogen, USA). In brief, 24 hr prior to transfection, cells were seeded without antibiotics in 6-well plate at 3 × 105 cells/well, corresponding to a density of 80% at the time of transfection. 4 μg plasmids and 8 μL LipofectamineTM 2000 were mixed respectively with RPMI1640 without FBS. These reagents were combined and incubated for 20 min before adding the cells in the mixed liquor. Cells were incubated at 37°C for 8 hr, then fresh RPMI1640 with 10% FBS was added. After another 48 hr cultivation, 400 μg/mL G418 (Promega, USA) was added in. When the cell clones formed after 14 days' growth, cells were screened out to be kept on cultivating. At last, the stable transfection 7721 cell clones were collected and given extended culture.
RNA preparation and semi-quantitative real-time PCR
Total cellular RNA was extracted from 1 × 106 cells using TRIzol reagent (Invitrogen, USA). The first strand cDNA was prepared using the Superscript Amplification System kit (Promega, USA) according to the manufacturer's instructions. For PCR, the primer sequences and expected product sizes were as follows: c-FLIP (512 bp), Forward: 5'-ATGTCTGCTGAAGTCAT CC-3', Back: 5'-ATCCTCACCAATCTCCTGCC-3'; β-actin (475 bp), Forward: 5'-TGACGGGGTCACCCACACTGTGCC-3', Back: 5'-CTGCATCCTGTCGGCAATGCCAG-3. Amplification was performed for 25 cycles (15 s denaturing at 95°C, 20 s annealing at 55°C, and 20 s extension at 72°C) in a PERKIN ELMER Thermal Cycler PE2400.
The PCR products were analyzed on 2% agarose gels and visualized by ethidium bromide staining. Quantitation of expression levels was achieved after adjustment for the expression levels of the housekeeping gene β-actin by densitometry (Bio-Rad, USA). The relative level of expression was then represented as the ratio of c-FLIP/β-actin.
Western Blot Analysis
The transfected 7721 cells were incubated for 30 min at 4°C in lysis buffer [16]. Lysates were cleared at 10,000 × g for 10 min at 4°C. Cell lysates were washed three times in cold lysis buffer. 100 μg of total protein was loaded on SDS-polyacrylamide gels, separated by electrophoresis, and transferred to nitrocellulose membranes (Millipore, USA) using standard procedures. The blots were stripped. Blocking of membranes and incubation with the primary (anti-c-FLIP multiclonal Abs) and appropriate secondary Abs were performed. Bands were visualized with an ECL detection kit (Amersham Biosciences, USA).
Immunocytochemical procedure
Cells were fixed in situ in paraformaldehyde (4% in PBS), and smeared onto slides precoated with 0.01% poly-L-lysine and air dried for 48 hr. Slides were washed in PBS and put into 3% H2O2 for 15 min to remove endogenous peroxidase activity. Slides were incubated overnight at 4°C with rabbit anti-human c-FLIP polyclonal antibodies. Incubation with PBS instead of the primary antibody served as a negative control. After washing twice with PBS for 2 min each, immunostaining was performed using the standard S-P technique and visualized with diaminobenzidine tetrahydrochloride solution.
Cell viability assays
For cell viability determination, 2 × 104 cell/well cell suspension was plated in 96-well microplates. After treated with doxorubicin for 0–8 days, the number of cells per well is obtained by using counting chamber.
Determination of apoptosis by TUNEL
Cells were treated with the indicated doses of doxorubicin for 48 hr, and then carefully harvested by centrifugation and reattached to gelatin-covered glass slides before labeling. In brief, cells (5 × 107/mL) were fixed in 4% formaldehyde in PBS for 25 min at 4°C. Each glass slide was added 50–100 μL of cell suspension. After air-dry slides at room temperature for 5 min, slides were then washed with PBS for two times. The slides were put into 2% H2O2 for 5 minutes to remove endogenous peroxidase activity. After removing excess liquid carefully, 50 μL of incubation buffer (45 μL equilibration buffer, 5 μL nucleotide mix containing fluorescein-12-dUTP, and 1 μL terminal deoxynucleotidyl transferase enzyme) were added to each sample. For negative controls: Prepare a control incubation buffer without TdT Enzyme by combining 45 μL of Equilibration Buffer, 5 μL of Nucleotide Mix and 1 μL of autoclaved, deionized water. They were covered with chambered coverslip caps and placed in an incubator under a humidified atmosphere at 37°C for 60 min. Slides were then dipped in stop solution, and incubated 30 min at 37°C. After being washed with PBS at room temperature, the slides were observed under a fluorescence microscope. Apoptosis was indicated by the presence of green or yellow-green fluorescence within the nucleus of cells as confirmation of fluorescein-12-dUTP incorporation at 3'-OH ends of fragmented DNA.
Statistical analysis
Differences in positive immunostaining rates and expression levels were analyzed by Chi-square test, and comparison of survival curves by Mantel-Cox test, with the software GraphPad Prism 5. The significance was set at P < 0.05.
