Materials
Gastric adenocarcinoma cell line MKN45 was provided by Shanghai Institute of Biotechnology and preserved by our department. Gastric cell line HFE145 was preserved by our department[9]. FBG2 monoclonal antibody was purchased from Abcam company (USA), PCDNA3.1 vector was preserved by our department, common cell culture plates were purchased from Orange Company(Belgium). Transwell cell culture plates were purchased from Castar Company(USA). AnexinV-FITC apoptosis detection kit was purchased from Beijing Biosea Biotechnology Co., Ltd. All the primers used in this research were synthesized by Shanghai Boya Biotechnology Co., Ltd.
Expression of FBG2 gene in MKN45 and HFE145
Expressions of FBG2 gene in gastric adenocarcinoma cell strain MKN45 and normal gastric cell strain HFE145 were detected to determine whether the cell lines could used in the research. RT-PCR and immunocytochemical assay were performed to detect the expression of FBG2 in cells, and the results showed that these cell strain were all FBG2 defective cell strains, which were suitable for gene transfection experiment in the research.
Construction and identification of PC-FBG2 vector
The cDNA of FBG2 gene was obtained by RT-PCR from total RNA of human gastric adenocarcinoma tissues which was used as the templet for PCR. Inner and external primers for nested PCR were synthesized respectively: S: 5' GGGGTACCCCAGGCCATGGATGCTC 3' 129 A: 5' CGGGATCCAACCGGGGCAGGAGTCG 3' 1104 (external primer) S: 5' GGGGTACCATGGATGCTCCCCACTC 3' 136 A: 5' CGGGATCCATGGACAGCTGTCAGAA 3' 1024 (Inner primer)
With the templet of total RNA from gastric adenocarcinoma tissues, nested PCR was performed to obtain the CDS double strand DNA fragments of FBG2 gene with KpnI and BamHI restriction sites in the two ends after two cycles of reactions. KpnI and BamHI were used to incise this double strand fragments and PCDNA3.1 vector. After these incised products were purified, they were kept at 16°C over night for ligation under the actions of T4 ligase. Then the ligated products were used to transform DH5α competent cells, and antibiotic screening was performed. PCR identification was conducted to select positive clones. After amplification culture, positive clones were identified by KpnI and BamHI incision. The confirmed positive clones were sent for sequencing, and eukaryon vectors PC-FBG2 with completely correct sequence of FBG2 gene were obtained.
Transfection of PC-FBG2 vector in MKN45 and HFE145 cells
DMEM culture medium with 10% fetal calf serum was used to culture the MKN45 and HFE145 cells in 12-well cell culture plates until the cells covered 90%–95% of the area. Serum-free DMEM was used for culture over night. Lipofectamine2000 liposome transfection kit was used. According to the directions for use, liposome and PC-FBG2 vector DNA were mixed and added into each well. PCDNA3.1 empty vector transfection group and blank control group (only liposome was added, and there was no vector DNA) were established. Transfection was completed after 24 hours' incubation.
Selection of cell strains with stable expression of FBG2
Transfected cells were diluted the into 24-well culture plates according to the proportion of 1:20. Then they were selected in medium containing G418. The concentration of G418 was based on the results of preliminary tests (800 μg/ml for MKN45 and 1000 μg/ml for HFE145, the concentration at which there were no surviving cells at 7 days after the time when cells covered 90% of the area of the wells in 6-well culture plate). The selection process continued for 31 days to allow colony formation. Colonies resistant to G418 were isolated with cloning cylinders and transferred into 24-well dishes. 12 and 7 positive clones were respectively obtained in the PC-FBG2 vector transfection group(MKN-FBG2) and PCDNA3.1 empty vector transfection group(MKN-PC) in MKN45 cell line. Then 9 and 5 positive clones were obtained respectively(HFE-FBG2 and HFE-PC) in the two transfection groups in HFE145 cell line. These selected clones were taken for identification and frozen for future use.
Analysis of transfectants
RT-PCR and Western blotting analysis were respectively performed to detect the mRNA and protein of FBG2, and immunocytochemical analysis was used to detect the expression of FBG2 protein in situ.
Cell growth curve assay
All of 12 MKN-FBG2 cell clones and 9 HFE-FBG2 which stable expressed FBG2 were used. 12 clones which were transfected by PCDNA3.1 empty vector and untreated cell strains were used as control groups. The cells of each clone were inoculated into 24-well culture plate at the concentration of 5 × 104/ml. After the cells completely adhered to the wall, they were washed once with PBS and then trypsinized in 0.5 ml of Trypsin/EDTA and counted in triplicates at 1 to 7 day using a cell counter (Beckman Coulter, Inc., Fullerton, CA). The mean values of all 12 MKN-FBG2 cell clones and 9 HFE-FBG2 on different time were calculated, and growth curves were plotted. In addition, MKN-PC cell clones, HFE-PC cell clones and untreated cell clones were used as control groups.
Analysis of cell cycle and apoptosis
FBG2 gene stable expression cell groups(MKN-FBG2, HFE-FBG2), PCDNA3.1 empty vector transfection groups(MKN-PC, HFE-PC) and untreated cell control groups were detected by flow cytometry. When the cells covered 70% of the area of cell culture plates in each group, serum-free culture medium was used for synchronization. After 24 hours' continuous culture, the cells were harvested and fixed by 100% ethanol, then prepared for single cell suspensions. After DNA staining, the cell cycles of the samples were measured on a FACS Calibur cytometer. The analysis software was CellQuest. After synchronization and 24 hours' continuous culture, the cells were harvested and fixed, PI and AnexinV-FITC double staining was performed, and flow cytometry was used to detect the apoptosis of cells. 3 replicate tests on every clone were performed in each group, the average values of three groups were calculated respectively, and comparison between three groups was conducted.
Colony formation assay
MKN-FBG2, HFE-FBG2, MKN-PC, HFE-PC and untreated cell control groups were detected. 1000 cells of each clone were respectively seeded in a 9 cm cell culture dish. After 18 days' culture in DMEM containing fetal calf serum, the number of cell clones with more than 50 cells was counted under microscope in each dash (clone formation rate = number of clones in each dish/1000). Three reduplicate dishes were used from each clone. Cell colonies were then fixed and stained with 0.5% methylene blue (Sigma, Poole, Dorset, U.K.) in ethanol. All colonies visible by eye were counted separately for each sample and evaluated their clone formation rates.
Cell migration assay
Cell migration assays were performed using FCS-coated polycarbonate filters (8 μm pore size; Transwell)[10]. The membrane undersurface was coated with 200 μl FCS for 1 hr at 37°C and blocked with 200 μl migration buffer (0.5% BSA in DMEM) for 30 min at 37°C. The lower chamber was filled with 500 μl of migration buffer, following which cells were plated in the upper chamber of 4 wells per treatment at a density of 1 × 105 in 100 μl of migration buffer and incubated at 37°C for 4 hr. Following incubation, cells in the upper compartment were trypsinized and counted by the CASY 1 counter (Sharfe System, Reutingen, Germany). Cells that had migrated to the lower surface of the filter were also trypsinized and counted. The migration rate was obtained by dividing the cell number in the lower chamber by the sum of the cell number found in both the lower chamber and the upper chamber ×100.
Statistics
SPSS11.0 statistical software was used. Two-factor and one-factor analysis of variance was used for statistical analysis.
