Mice
Balb/c mice (female and male are half-and-half, 16 g-18 g of weight) were purchased from animal center of ChongQing Medical University and maintained under specific pathogen-free conditions until use in animal facilities. Their housing, care, diet and maintenance conformed to the guidelines of China, the "regulation for the care and use of laboratory animals".
Cell lines
The murine colon carcinoma cell line CT26 and human embryonic kidney (HEK) 293 cell lines (SIBCB, China) were cultured at 37°C and 5% CO2 in RPMI 1640 (Gibco, America) medium, containing 10% fetal calf serum (PAA, Austria).
Preparation of donor BMC and IBM injection of BMCs
The BMCs were collected from the femurs and tibias of Balb/c mice and injected via IBM, as described in[9], and then cultured at a density of 2 × 105 cells/ml in IMDM media supplemented with bovine serum albumin and L-glutamine. Cultures were stimulated with a combination of the cytokines, thrombopoietin (10 ng/ml), flt3-ligand (10 ng/ml), stem cell factor (20 ng/ml), granulocyte colony-stimulating factor (15 ng/ml), interleukin (IL)-3 (10 ng/ml) and IL-6 (25 ng/ml). (R&D, America). Cells were populated two days after primary culture, and co-cultured with Ad-EGFP-MDR1 (kindly presented by professor Tong-Chuan He, EGFP:enhanced green fluorescence protein) (MOI 50) for two days. The cultured cells were washed by phosphate buffered sodium (PBS) for three times and harvested. Total RNA of cells was isolated and qualitatively analyzed with a reverse transcription polymerase chain reaction (RT-PCR) kit (Takara, Japan). For MDR1: forward primer: AAAGCTGTCAAGGAAGCCAA, reverse primer: ACTCCATCATCGAAACCAGC. For beta-actin, forward primer: AAGTGTGACGTTGACATCCG, Reverse primer: GAAAGGGTGTAAAACGCAGC. Reverse transcriptase reaction was performed with PCR conditions were as follows: 94°C for 2 min (1 cycle); followed 94°C for 20 sec, 55°C for 1 min, 72°C for 30 sec (30 cycle); followed 72°C for 10 min(1 cycle). P-gp activity was determined by using the daunomycin efflux assay and detected by fluorescence microscope. P-gp in BMCs was investigated by western bolt. BMCs were washed once with PBS and lysed in lysis buffer. The protein concentration was determined by BCA protein assay (Pierce). The cellular fractions were subjected to SDS-PAGE [10% (w/v)] gel. The separated proteins were electroblotted on polyvinyliden difluoride (PVDF) membranes (Millipore), which were then washed once with Tris buffered saline containing Tween 20 (TBS-T), and then blocked in blocking buffer for 2 h. After washing with TBS-T, the membranes were probed with antibodies (Santa Cruz) at a dilution of 1:1000 in TBS-T. After three washes with TBS-T, membranes were treated for 1 h with HRP-conjugated, indicated antibodies diluted to 1:10,000 in TBS-T. After three washes with TBS-T, immunoreactive protein bands were revealed with an ECL Western blot analysis system (Bio-Rad). Films were scanned and analyzed with Quantity One software (Bio-Rad). In addition cell viability was assessed with a trypan blue dye exclusion test. Cell quantification was carried out using a haemocytometer and an optical microscope. The successful infected BMCs with green fluorescence were determined by flow cytometry.
The donor BMCs were injected from the femurs into the bone marrow cavity using a microsyringe containing the donor BMCs (2 × 106/30 μl). Anesthesia for transplantation: the mice were given Sumianxin (a mixture of xylidinothiazoline, edathamil, dihydroetorphine hydrochloride and haloperidol) (AMMS, China) 0.5 ml/kg via intramuscular injection. At the end of the transplantation the mice were observed from the anesthesia.
Experimental protocols
Mice were randomly assigned to four groups, 20 animals in each. For establishment of tumors, Balb/c mice were injected with 5 × 107/ml, 100 μl CT 26 cells into the right armpit. 10 days after injection, the tumor size was detected by ultrasound, then chemotherapy was started with 25 mg/kg 5-FU via intraperitoneal injection once a day for 5 days, a week constituting one therapeutic course and with 0.02 mg/kg vincristine via intraperitoneal at the first day of each week.
Mice in Group A were tumor-bearing and transplanted with the transfected MDR1-BMCs via IBM-BMT (Tumor+chemotherapy+MDR1-IBM-BMT). Mice in Group B were tumor-bearing and transplanted untreated BMCs via IBM-BMT (Tumor + chemotherapy + IBM-BMT). Mice in Group C were no tumor with the MDR1-BMCs via IBM-BMT and chemotherapy (No tumor + chemotherapy + MDR1-IBM-BMT). Group D was prepared as control, in this group PBS was used instead of tumor xenograft, transplantation and chemotherapy (No tumor + No tranplatation + No chemotherapy). On the second day after the end of 5-Fu chemotherapy in the first week, the mice were transplanted with BMCs by IBM injections.
Posttransplantation management
75% Alcohol and gentamycin were administered to the surgical wound everyday for one week. Each mouse was observed once every morning throughout the transplantation for changes in general appearance and behavior. Body weights were measured twice a week. Food consumption was qualitatively assessed daily for each group.
Blood samples were collected via caudal vein once pretreatment and on Day 1, 3, 14 and 30 posttransplantation for analysis by automated hematology analyzer (KX-21, Sysmex Inc, Japan).
Detection of human MDR1 gene biodistribution
Mice were necropsied on Day 3, 7, 14, 21 and 30, with three samples necropsied at one time. And the following tissues were collected: bone marrow, brain, heart, liver, kidneys, spleen, lungs and intestine. Tumors were also collected from the group A and B. Tissues were taken macroscopic examination and preserved in neutral-buffered 10% formalin. After 48 hours, the tissues were embedded in paraffin, stained with hematoxylin and eosin, and microscopically examined. A tissue microarray (TMA) was constructed (6 mm ×4 μm). Two duplicate specimens from each sample were placed on the array. Paraffin-embedded sections were stained with standard immunohistochemical techniques as introduced in [10].
In situ hybridization experiments were carried out with a mixture of specific digoxin-labeled oligonucleotide anti-sense probe for the human MDR1 (TBD, China). The MDR1 DNA probe consisted of the fragment corresponding to nucleotides 514-482 of the human MDR1 mRNA (genebank accession number AF016535). ISH signals were scored with a fluorescence microscope (Olympus BX51, Tokyo, Japan). In situ hybridization was performed on paraffin-embeds tissue sections according to the manufacturer's protocol. The positive signal for human MDR1 was detected with fluorescein isothiocyanate. Consecutive tissue sections were also hybridized with sense probe under the same conditions.
Detection of Adenovirus-specific antibody and Serum neutralizing factors (SNF)
Adenovirus-specific antibody levels were evaluated by ELISA on Day 3, 7, 14 days after transplantation. Diluted serum samples were added to 96-well microtitier plates coated with the protein of adenovirus. Each sample had duplicate determination, tetramethylbenzidin were added to produce a colored reaction. The absorbance was read at 450 nm with a reference filter of 650 nm with the microplate reader.
To detect SNF against Ad-EGFP-MDR1, serum was incubated at 55°C for 30 min to inactivate complement. 2 × 105/well HEK 293 cells were plated into 24-well plates (BD, America) and incubated for four hours before sample dilution. Serum was incubated with equal volume of Ad-EGFP-MDR1 (MOI 10) for 1 hour at 37°C. The serum/Ad-EGFP-MDR1 mixtures were transferred onto the HEK293 cell and incubated 4 hours, supernatant was removed and fresh medium was added. The green fluorescence of cells was measured with flow cytometry at 24 hours after incubation. [11]
Statistical analysis
Hematology and ELISA results were expressed as mean ± standard error (S.E). Data were analyzed using unpaired student's t-test, or one-way analysis of variance ANOVA with SAS (Biostatistics department, Chongqing Medical University). Significance was set at P < 0.05.
