Mice

Balb/c mice (female and male are half-and-half, 16 g-18 g of weight) were purchased from animal center of ChongQing Medical University and maintained under specific pathogen-free conditions until use in animal facilities. Their housing, care, diet and maintenance conformed to the guidelines of China, the "regulation for the care and use of laboratory animals".

Cell lines

The murine colon carcinoma cell line CT26 and human embryonic kidney (HEK) 293 cell lines (SIBCB, China) were cultured at 37°C and 5% CO2 in RPMI 1640 (Gibco, America) medium, containing 10% fetal calf serum (PAA, Austria).

Preparation of donor BMC and IBM injection of BMCs

The BMCs were collected from the femurs and tibias of Balb/c mice and injected via IBM, as described in[9], and then cultured at a density of 2 × 10⁵ cells/ml in IMDM media supplemented with bovine serum albumin and L-glutamine. Cultures were stimulated with a combination of the cytokines, thrombopoietin (10 ng/ml), flt3-ligand (10 ng/ml), stem cell factor (20 ng/ml), granulocyte colony-stimulating factor (15 ng/ml), interleukin (IL)-3 (10 ng/ml) and IL-6 (25 ng/ml). (R&D, America). Cells were populated two days after primary culture, and co-cultured with Ad-EGFP-MDR1 (kindly presented by professor Tong-Chuan He, EGFP:enhanced green fluorescence protein) (MOI 50) for two days. The cultured cells were washed by phosphate buffered sodium (PBS) for three times and harvested. Total RNA of cells was isolated and qualitatively analyzed with a reverse transcription polymerase chain reaction (RT-PCR) kit (Takara, Japan). For MDR1: forward primer: AAAGCTGTCAAGGAAGCCAA, reverse primer: ACTCCATCATCGAAACCAGC. For beta-actin, forward primer: AAGTGTGACGTTGACATCCG, Reverse primer: GAAAGGGTGTAAAACGCAGC. Reverse transcriptase reaction was performed with PCR conditions were as follows: 94°C for 2 min (1 cycle); followed 94°C for 20 sec, 55°C for 1 min, 72°C for 30 sec (30 cycle); followed 72°C for 10 min(1 cycle). P-gp activity was determined by using the daunomycin efflux assay and detected by fluorescence microscope. P-gp in BMCs was investigated by western bolt. BMCs were washed once with PBS and lysed in lysis buffer. The protein concentration was determined by BCA protein assay (Pierce). The cellular fractions were subjected to SDS-PAGE [10% (w/v)] gel. The separated proteins were electroblotted on polyvinyliden difluoride (PVDF) membranes (Millipore), which were then washed once with Tris buffered saline containing Tween 20 (TBS-T), and then blocked in blocking buffer for 2 h. After washing with TBS-T, the membranes were probed with antibodies (Santa Cruz) at a dilution of 1:1000 in TBS-T. After three washes with TBS-T, membranes were treated for 1 h with HRP-conjugated, indicated antibodies diluted to 1:10,000 in TBS-T. After three washes with TBS-T, immunoreactive protein bands were revealed with an ECL Western blot analysis system (Bio-Rad). Films were scanned and analyzed with Quantity One software (Bio-Rad). In addition cell viability was assessed with a trypan blue dye exclusion test. Cell quantification was carried out using a haemocytometer and an optical microscope. The successful infected BMCs with green fluorescence were determined by flow cytometry.

The donor BMCs were injected from the femurs into the bone marrow cavity using a microsyringe containing the donor BMCs (2 × 10⁶/30 μl). Anesthesia for transplantation: the mice were given Sumianxin (a mixture of xylidinothiazoline, edathamil, dihydroetorphine hydrochloride and haloperidol) (AMMS, China) 0.5 ml/kg via intramuscular injection. At the end of the transplantation the mice were observed from the anesthesia.

Experimental protocols

Mice were randomly assigned to four groups, 20 animals in each. For establishment of tumors, Balb/c mice were injected with 5 × 10⁷/ml, 100 μl CT 26 cells into the right armpit. 10 days after injection, the tumor size was detected by ultrasound, then chemotherapy was started with 25 mg/kg 5-FU via intraperitoneal injection once a day for 5 days, a week constituting one therapeutic course and with 0.02 mg/kg vincristine via intraperitoneal at the first day of each week.

Mice in Group A were tumor-bearing and transplanted with the transfected MDR1-BMCs via IBM-BMT (Tumor+chemotherapy+MDR1-IBM-BMT). Mice in Group B were tumor-bearing and transplanted untreated BMCs via IBM-BMT (Tumor + chemotherapy + IBM-BMT). Mice in Group C were no tumor with the MDR1-BMCs via IBM-BMT and chemotherapy (No tumor + chemotherapy + MDR1-IBM-BMT). Group D was prepared as control, in this group PBS was used instead of tumor xenograft, transplantation and chemotherapy (No tumor + No tranplatation + No chemotherapy). On the second day after the end of 5-Fu chemotherapy in the first week, the mice were transplanted with BMCs by IBM injections.

Posttransplantation management

75% Alcohol and gentamycin were administered to the surgical wound everyday for one week. Each mouse was observed once every morning throughout the transplantation for changes in general appearance and behavior. Body weights were measured twice a week. Food consumption was qualitatively assessed daily for each group.

Blood samples were collected via caudal vein once pretreatment and on Day 1, 3, 14 and 30 posttransplantation for analysis by automated hematology analyzer (KX-21, Sysmex Inc, Japan).

Detection of human MDR1 gene biodistribution

Mice were necropsied on Day 3, 7, 14, 21 and 30, with three samples necropsied at one time. And the following tissues were collected: bone marrow, brain, heart, liver, kidneys, spleen, lungs and intestine. Tumors were also collected from the group A and B. Tissues were taken macroscopic examination and preserved in neutral-buffered 10% formalin. After 48 hours, the tissues were embedded in paraffin, stained with hematoxylin and eosin, and microscopically examined. A tissue microarray (TMA) was constructed (6 mm ×4 μm). Two duplicate specimens from each sample were placed on the array. Paraffin-embedded sections were stained with standard immunohistochemical techniques as introduced in [10].

In situ hybridization experiments were carried out with a mixture of specific digoxin-labeled oligonucleotide anti-sense probe for the human MDR1 (TBD, China). The MDR1 DNA probe consisted of the fragment corresponding to nucleotides 514-482 of the human MDR1 mRNA (genebank accession number AF016535). ISH signals were scored with a fluorescence microscope (Olympus BX51, Tokyo, Japan). In situ hybridization was performed on paraffin-embeds tissue sections according to the manufacturer's protocol. The positive signal for human MDR1 was detected with fluorescein isothiocyanate. Consecutive tissue sections were also hybridized with sense probe under the same conditions.

Detection of Adenovirus-specific antibody and Serum neutralizing factors (SNF)

Adenovirus-specific antibody levels were evaluated by ELISA on Day 3, 7, 14 days after transplantation. Diluted serum samples were added to 96-well microtitier plates coated with the protein of adenovirus. Each sample had duplicate determination, tetramethylbenzidin were added to produce a colored reaction. The absorbance was read at 450 nm with a reference filter of 650 nm with the microplate reader.

To detect SNF against Ad-EGFP-MDR1, serum was incubated at 55°C for 30 min to inactivate complement. 2 × 10⁵/well HEK 293 cells were plated into 24-well plates (BD, America) and incubated for four hours before sample dilution. Serum was incubated with equal volume of Ad-EGFP-MDR1 (MOI 10) for 1 hour at 37°C. The serum/Ad-EGFP-MDR1 mixtures were transferred onto the HEK293 cell and incubated 4 hours, supernatant was removed and fresh medium was added. The green fluorescence of cells was measured with flow cytometry at 24 hours after incubation. [11]

Statistical analysis

Hematology and ELISA results were expressed as mean ± standard error (S.E). Data were analyzed using unpaired student's t-test, or one-way analysis of variance ANOVA with SAS (Biostatistics department, Chongqing Medical University). Significance was set at P < 0.05.

The transfected BMCs and macroscopic observations

Expression of EGFP was detected by fluorescence microscope to observe the infection efficiency of Ad-EGFP-MDR1 on BMCs. The subsequent distribution of the daunomycin was also monitored by the fluorescence microscope. Most of daunomycin aggregated inside the BMCs which were not infected with the adenovirus. MDR1 could effectively express in cells infected with Ad-EGFP-MDR1 and reduce the accumulation of daunomycin. (Figure 1) MDR1 mRNA highly expressed in the treated BMCs which showed a unique MDR1 specific band compared with the untreated cells. (Figure 1) We studied the effects of Ad-EGFP-MDR1 on BMCs. An increase in the BMCs expression of P-gp was seen. (Figure 1) Every group of BMCs cultured was low viability losses, maintaining cell culture viability above 88% [see Additional file 1]. BMCs infected with Ad-EGFP-mdr1 successfully would show green under fluorescence channel analyses by flow cytometry. The infection rate of BMCs incubated with Ad-EGFP-MDR1 was obviously higher than that of control group. The infection rate of BMCs incubated with Ad-EGFP-mdr1 for 48 h was about 24.3%, and the background was about 0.4%.

About 10-12 days after injection, a neoplasm size from 3 mm × 3 mm × 4 mm to 5 mm × 5 mm × 7 mm appeared in the axillary area of mice in group A and B [see Additional file 2]. Then the mice became inactive and had reduced food consumption 1 month after transplantation. And the relative tumor weights in group A and B significantly increased. Two mice died in group B and one in group A, and the remaining mice of these two groups survived for more than 2 months.

The appearance of lung, liver and spleen changed in group A and B at the advanced stage. The thoracic cavity and venous drainage were compressed by the grown neoplasm, which led to splenomegaly, enlargement of the liver and hydrothorax.

Histopathology

Morphology examination was performed on Day 3, 7, 14, 21, 30 after transplantation. Mice showed no significant pathological changes in the brain, lung, heart, kidneys, spleen, liver and intestine at the first week after posttreatment. However, on Day 21 and 30, lesions including cardiac dilatation, congested lungs and hydrothorax occurred in mice in group A and B. At the same time, mild hydropic degeneration was found in the centrilobular regions of liver lobules, mild lymphoid and megakaryocytic hyperplasia was shown in the spleen, ascites and abnormalities of central nervous system and digestive system were not manifested. Histology was normal for mice in group C and D.

Immunobiology

The levels of adenovirus-specific antibody were measured by ELISA. Optical density (OD) of group A and C had no significant difference with that of group B and D. (Figure 2) [see Additional file 3] It could be inferred that the levels of adenovirus-specific antibody of group A and C did not increase on Day 3, 7, 14 after transplantation.

Fluorescence intensity of infected HEK 293 cells, which was measured with a flow cytometry, was inversely proportional to SNF level. The SNF could inhibit the infection efficiency of Ad-EGFP-MDR1 and result in the reduction of the fluorescence intensity. However, almost all samples were infected, the percentages of green fluorescence (infected BMCs) were 99.21%, 99.22%, 98.65% and 99.39% for group A to D respectively on Day 7 posttransplantation. The background was 2.45%. (Figure 3) [see Additional file 4] We inferred that SNF against Ad-EGFP-MDR1 was not detected in all groups.

Tissue distribution of Ad-EGFP-MDR1

Tissue distribution of Ad-EGFP-MDR1 was assessed by immunohistochemistry and in situ hybridization. Transgene expression was detected at higher frequency in necroscopy of the major tissue of all groups. On Day 7 after BMT, expression of human MDR1 and P-gp could be detected in kidney, lung and intestine of mice in group A and C (Figure 4). [see Additional file 5] And it was higher obviously on day 14 and lower on day 30 (Figure 4), while not detected in any tissue of group B and D at any time (Figure 5). Human MDR1 predominantly expressed in bone marrow cells and could still be detected on Day 30 posttreatment, but its expression was not detected in the liver, spleen, brain and tumor tissues in our study.

Hematology analysis

There were some changes in hematology parameters. In group A and C, white blood cell (WBC) counts, haemoglobin (Hb), red blood cell (RBC) counts and platelet (Plt) counts decreased after 3 days of IBM-BMT. But only WBC counts in group C at that time had statistically significant difference compared with group D (P <0.05). WBC counts and Plt counts in group A increased as the tumor's growthing. It could be inferred that the tumor might stimulate myelopoiesis and cause a leukemoid reaction. However, at the end of first chemotherapy they decreased with statistical significance (P < 0.05). On Day 30 after BMT, the counts of peripheral hematocyte in group A and C were close to that in group D, and no significant morphological abnormality was found in the recovering hematocyte. [see Additional file 6] It demonstrated that the transplantation of MDR1-BMCs was able to reconstitute the hematopoietic system.