- Research
- Open access
- Published:
Subtype-specific kinase dependency regulates growth and metastasis of poor-prognosis mesenchymal colorectal cancer
Journal of Experimental & Clinical Cancer Research volumeĀ 42, ArticleĀ number:Ā 56 (2023)
Abstract
Background
Colorectal cancer (CRC) can be divided into four consensus molecular subtypes (CMS), each with distinct biological features. CMS4 is associated with epithelial-mesenchymal transition and stromal infiltration (Guinney et al., Nat Med 21:1350ā6, 2015; Linnekamp et al., Cell Death Differ 25:616ā33, 2018), whereas clinically it is characterized by lower responses to adjuvant therapy, higher incidence of metastatic spreading and hence dismal prognosis (Buikhuisen et al., Oncogenesis 9:66, 2020).
Methods
To understand the biology of the mesenchymal subtype and unveil specific vulnerabilities, a large CRISPR-Cas9 drop-out screen was performed on 14 subtyped CRC cell lines to uncover essential kinases in all CMSs. Dependency of CMS4 cells on p21-activated kinase 2 (PAK2) was validated in independent 2D and 3D in vitro cultures and in vivo models assessing primary and metastatic outgrowth in liver and peritoneum. TIRF microscopy was used to uncover actin cytoskeleton dynamics and focal adhesion localization upon PAK2 loss. Subsequent functional assays were performed to determine altered growth and invasion patterns.
Results
PAK2 was identified as a key kinase uniquely required for growth of the mesenchymal subtype CMS4, both in vitro and in vivo. PAK2 plays an important role in cellular attachment and cytoskeletal rearrangements (Coniglio et al., Mol Cell Biol 28:4162ā72, 2008; Grebenova et al., Sci Rep 9:17171, 2019). In agreement, deletion or inhibition of PAK2 impaired actin cytoskeleton dynamics in CMS4 cells and, as a consequence, significantly reduced invasive capacity, while it was dispensable for CMS2 cells. Clinical relevance of these findings was supported by the observation that deletion of PAK2 from CMS4 cells prevented metastatic spreading in vivo. Moreover, growth in a model for peritoneal metastasis was hampered when CMS4 tumor cells were deficient for PAK2.
Conclusion
Our data reveal a unique dependency of mesenchymal CRC and provide a rationale for PAK2 inhibition to target this aggressive subgroup of colorectal cancer.
Background
Colorectal cancer (CRC) is a heterogeneous disease at both the molecular and clinical level. There are two major groups by which CRC is classically identified: the chromosomal instable (CIN) and microsatellite instable (MSI), the former encompassing the majority of cases [1, 2]. Although this classification system is clinically insightful to some extent, it does not fully explain the differences in treatment responses or prognosis, and neither do common mutations or dysregulated pathways [3]. Therefore, mRNA expression-based classification of CRC was employed to capture the heterogeneity present in this disease and this has resulted in the definition of consensus molecular subtypes (CMSs) [1, 2, 4]. CMS classification recognizes MSI tumors mainly as CMS1, whilst the majority of CIN tumors are subdivided over CMS2-4. Part of the distinct gene expression patterns found in each subtype can be attributed to infiltration or presence of a uniquely shaped microenvironment. Specifically, CMS4 cancers are characterized by an abundant stromal infiltrate, mainly consisting of fibroblasts, which contributes to the mesenchymal gene expression program in this subtype, while CMS1 is defined by high immune infiltrate [5, 6]. Importantly, not only do the four subtypes possess clearly distinct biological features, they also follow a different clinical course. Specifically, the mesenchymal subgroup CMS4 has received attention due to its enhanced capacity of metastatic spreading and its poor response to therapy [7]. We and others have shown that in vitro cultures retain a large part of the differential CMS pathway activity found in tumors even though the gene expression programs emanating from the stromal compartment are lacking in this setting. Tumor cell intrinsic gene expression differences are thus translated to (primary) cell cultures, allowing for the identification of all 4 subtypes in CRC pre-clinical models [8,9,10]. Supporting this notion is the fact that growth patterns of mesenchymal CMS4 CRC cell lines are evidently distinct from the more epithelial CMS2 and CMS3 lines and on average show less cell-to-cell contact and a more elongated phenotype [8, 10]. In addition, CMS4 is associated strongly with metastatic spreading in in vivo mouse models [11,12,13].
We hypothesized that these biologically distinct features of CRC subtypes translate into unique dependencies for growth and survival. To identify CMS-selective sensitivities, a CRISPR-Cas9-based drop-out screen targeting the kinome was performed. Using this approach, multiple CMS-specific essential kinases were identified, confirming the distinct wiring of the subtypes. Subsequently, we zoomed in on dependencies identified in the aggressive CMS4 cell lines and validated the top hit, PAK2, to be a CMS4-specific drop-out crucial for outgrowth of these lines both in vitro and in vivo. Importantly, PAK2 was not differentially expressed between subtypes and the dependency of the mesenchymal lines on this kinase was shown to relate to its essential role in actin cytoskeletal remodeling. Additionally, CMS4 lines were more sensitive to chemical PAK inhibition and require PAK2 for invasion and in vivo metastasis.
Materials and methods
Cell and organoid culture, lentivirus packaging and transduction
Human colon cancer cell lines were a kind gift from the Sanger Institute (Cambridge, United Kingdom). CaR-1, HT55, Hutu-80, LS123, LS180, OUMS-23, RKO, SW48 and SW948 were cultured in 1:1 DMEM/F12 medium containing 15āmM HEPES and 2,5āmMāL-glutamine (Cat. #31330095, Gibco) supplemented with 8% fetal bovine serum (FBS) (Cat. #s-FBS-SA-025, Serana) and 50āunits/mL of penicillin/streptomycin (Cat. #15140122, Gibco). Colo320-HSR, HCT116, KM12, LS513, LS1034, MDST8 and RCM-1 were maintained in RPMI 1640 medium containing 25āmM HEPES and 2,05āmMāL-glutamine (Cat. #52400041, Gibco) supplemented with 8% FBS, 1% D-glucose solution plus (Cat. # G8769, Sigma-Aldrich), 1āmM sodium pyruvate (Cat. #11360070, Gibco) and 50āunits/mL of penicillin/streptomycin. HEK293T (ATCC) were cultured in DMEM medium (Cat. # BE12-614F, Lonza), supplemented with 8% FBS, glutamine and 50āunits/mL of penicillin/streptomycin. All lines were cultured in a humidified incubator at 37āĀ°C with 5% CO2. Phase contrast images of CRC cell lines were obtained on a Nikon Eclipse TS100 (HuTu-80, MDST8, OUMS23; Nikon Microscopy) and an EVOS FL auto (HT55; Life Technologies).
Human organoids p11t and p26t were cultured according to the protocol previously described by van de Wetering, et al. [14]. Organoids were dissociated once a week using TrypLE (Cat. # 12604013, ThermoFisher Scientific) and maintained in culture in a humidified incubator at 37āĀ°C with 5% CO2. Primary spheroid cultures CONC and Co108 were obtained and cultured in low-adherent plates in cancer stem cell medium as previously described [8]. Briefly, advanced DMEM/F12 medium was supplemented with D-glucose 0.15% (Sigma), HEPES 5āmM (Life Technologies), penicillin/streptomycin (PS), Heparin 2āĪ¼g/ml (Sigma), Insulin 10āĪ¼g/ml (Sigma), Ī²-mercaptoethanol 100āĪ¼M (Sigma), and trace element B and C (Fisher Scientific) with freshly added human EGF 20āng/ml (Peprotech) and FGF 10āng/ml. For the pTRIPZ transduced cell lines, Doxycycline was added to the medium at a concentration of 1āĪ¼g/ml for at least 3ādays before performing experiments.
Cell lines were authenticated by short-tandem-repeat DNA profiling using the using the PowerPlex 16Ā® system (Cat. #DC6531, Promega) according to the manufacturerās protocol. Results were analyzed using GeneScanĀ® software (Applied Biosystems). Mycoplasma tests were performed once a month, positive cultures were immediately excluded from analysis and further use in experiments.
Plasmids used for this work are listed below, including the original source from which they were obtained.
Plasmid name | Source | Catalogue number/reference |
---|---|---|
psPAX2 | Addgene | 12,260 |
pMD2.G | Addgene | 12,259 |
LentiCRISPRv2.1 kinome library | Provided by Beijersbergen lab | 52,961 (backbone) |
pTRIPZ shRNA non-silencing control | Horizon Discovery | RHS4743 |
pTRIPZ shRNA PAK2 (sh-1) | Horizon Discovery | Clone V3THS_315625, RHS4696-200771936 |
pSpCas9(BB)-2A-GFP (pX458) | Addgene | 48,138 |
pLKO.1 non-silencing control | MISSIONĀ® TRC library, Merck | SHC002 |
pLKO.1 ARHGEF7 shRNA-1 | Provided by Versteeg lab | TRCN0000047593 |
pLKO.1 ARHGEF7 shRNA-2 | Provided by Versteeg lab | TRCN0000047596 |
pRRL-Lifeact-GFP | Provided by Huveneers lab | Ā |
pRRL-paxillin-mCherry | Provided by Huveneers lab | Ā |
pLV.CMV.H2B-Dendra2-bc-puro | Provided by van Rheenen lab | Alieva M. et al. 2017 Sci. Rep [15]. |
LeGO-T2 (tdTomato) | Addgene | 27,342 |
Lentivirus was produced in HEK293T cells using second generation packaging plasmids psPAX2 and pMD2.G. Cells were transfected overnight with 1āmg/ml PEI in a 1:2 plasmid:PEI ratio. Viral supernatant was collected 2 and 3ādays after transfection, pooled and filtered (0,45āĪ¼m). All transductions, except for transduction with the lentiCRISPRv2.1 kinome library (specified below) were carried out as follows: CRC cell lines were plated at ~ā80% confluency in medium containing lentiviral supernatant and 5āĪ¼g/ml polybrene, spinfected at 1800ārpm for 1āhr. in a pre-warmed plate in a Rotina 420R centrifuge (Hettich) at 32āĀ°C, and subsequently left overnight in the incubator. If applicable, puromycin selection medium was added 24āhr. post-transduction. Cultures successfully transduced with fluorescent protein plasmids were sorted on the BD FACS ARIAā¢ II SORP Cell Sorter (BD Biosciences).
CRISPR-based kinome essentiality screen
The kinome CRISPR sgRNA library was designed and generated at the Netherlands Cancer Institute (NKI) and contained 50 non-targeting sgRNAs, 50 sgRNAs targeting essential genes (COPB1, KPNB1, NUP98, PSMB2, PSMC4, PSMD6, PSMD11, RPL3, RPL11, RPS13) and 5860 sgRNAs targeting 502 kinases cloned into the LentiCRISPRv2.1 backbone through Gibson assembly. Plasmid library was expanded through electroporation into Enduraā¢ electrocompetent cells (Cat. #60242-0, Lucigen). Fourteen cell lines were lentivirally transduced in triplicate with the CRISPR kinome library at a multiplicity of infection of ~ā0.3. Successfully transduced cells were selected using puromycin for 48 (HCT116, HuTu-80, KM12, MDST8, OUMS-23, RKO, SW48) or 72āhours (Colo320-HSR, HT55, LS180, LS513, LS1034, RCM-1, SW948) after which the T0 reference sample was collected. All lines were cultured twice before final harvest and collection of the T1 sample after 9 divisions. Division time of each line was reported on before [8]. DNA was extracted from T0 and T1 samples and sequencing library was prepared by PCR using Phusionā¢ high fidelity DNA polymerase (Cat. #F530L, ThermoFisher Scientific) and sgRNA abundance in each replicate was determined through Illumina deep sequencing.
Normalization and a differential analysis of T1 versus T0 on the sgRNA level was performed using DESeq2 [16]. Raw normalized sgRNA counts per sample per cell line are available in Supplementary Table S1. A differential analysis of T1 versus T0 on the gene level was performed using MAGeCK [17], which provides a False Discovery Rate (FDR) value. At the time of analysis, MAGeCK output did not include the median of the Log2FoldChange of the āgood sgRNAsā (p.low ā¤0.25) and it was therefore calculated separately based on the DESeq2 results. PAK2 was identified as a CMS4-specific drop-out by comparing the fold depletion of abundance of PAK2-targeting sgRNAs in T1 to T0 in CMS4 versus CMS1ā3 cell lines, negative FDR threshold was set to ā¤0.01.
Data processing and gene expression normalization
Eleven publicly available datasets containing colorectal tumor samples from the Gene Expression Omnibus (GSE13067, GSE13294, GSE14333, GSE17536, GSE20916, GSE2109, GSE23878, GSE33113, GSE35896, GSE37892, and GSE39582) were downloaded and normalized using the rma function of the āaffyā package [18]. All these samples were combined with a private dataset (KFSYSCC) profiled on the same affymetrix platform (133plus2). Quantile normalization was performed on the combined samples prior to using the ComBat batch effect removal method [19].
RNAseq data for colorectal cancer tumor samples was obtained from the TCGA [2] dataset and normalized to the fpkm values. Normalized TCGA data and combined affymetrix datasets were aggregated into a single matrix of 2416 samples and the ComBat method was performed to further remove batch effects. AllĀ of these samples have been used in consensus molecular subtyping of colorectal cancer and CMS labels of samples were also defined during this work [4].
For the analysis of the cell line samples, datasets GSE36133, GSE100478, GSE59857 and GSE68950 containing profiles of established cancer cell lines and GSE100479 and GSE100549 containing profiles of primary cell lines, complemented with profiles of 9 spheroid cultures derived in in the laboratory of Prof. Dr. Giorgio Stassi in Palermo (unpublished data) were normalized and CMS stratified as previously described [7].
Heatmaps representative of the two top hits for each CMS subtype were generated using the pheatmap function of the āpheatmapā package from CRAN.
Competition assay
WT cells and stably transduced pTRIPZ shRNA non-silencing (NS) or PAK2-KD cell lines were treated for 6ādays with 1āĪ¼g/ml doxycycline to induce turboRFP and linked shRNA expression before sort. Left and right sort gate for 20% turboRFP-high, shRNA-high cells were set to capture 20% highest turbo-RFP expressing PAK2-KD cells in population and copied to NS cell line. NS and PAK2-KD shRNA-high cells were sorted in two separate tubes, after which live WT cells were sorted on top into both tubes to reach a final mixture of 70% shRNA-high and 30% WT cells in each tube. Sorted, non-mixed WT cells were included throughout the experiment as turboRFP-negative controls. Part of the shRNA-high + WT mixtures was plated in triplicate and remainder was analyzed on FACS to determine exact shRNA-high:WT cell ratio on day 0 post-sort in NSā+āWT and PAK2-KDā+āWT co-culture conditions. 7-AAD was used to exclude dead cells. Plated triplicates were maintained in culture and then harvested, passaged and analyzed on FACS on days 7, 10, 14, 17, 21, 24 and 28 post-sort using the same FACS laser intensity and gate settings as on day 0. 7-AAD was again used to exclude dead cells. Contribution of shRNA-high cells to both mixed populations was first normalized to their contribution (%) measured at day 0 post-sort. Percentages plotted in Fig.Ā 2E were obtained by subsequently setting NS shRNA contribution to 100% for each day and then normalizing PAK2-KD contribution to co-culture population to NS contribution.
Generation of stable CRISPR PAK2 knock-out clones
sgRNA sequence targeting PAK2 was available via the LentiCRISPRv2.1 kinome library: 5ā² ā TATGCCACTCTCTTACCAGG. sgRNA was cloned into pSpCas9(BB)-2A-GFP (pX458) as described [20] and obtained plasmid was transformed into One Shotā¢ TOP10 Chemically Competent cells (Cat. # C404003, ThermoFisher Scientific). Successful insertion of sgRNA was confirmed with Sanger sequencing. CRC cell lines were plated in a 6 well plate at a density to reach ~ā70ā80% confluency for transfection the next day with 2,5āĪ¼g plasmid and FuGENEĀ® HD Transfection Reagent (Cat. #E2311, Promega) in a 1:3 ratio. Transfection mixture was left overnight after which cells were expanded to a T25. Successfully transfected GFP positive cells were single cell sorted into 96-well plates. Single cell clones that successfully grew out were harvested and part expanded, part plated in a new 96-well plate to obtain DNA lysates. When wells on 96-well plate were full, medium was aspired, cells were washed with PBS and subsequently left in 50āĪ¼l trypsin per well at 37āĀ°C for 1āhr. to detach cells and partially disrupt membrane. Plates were frozen down, thawed and crude DNA lysates were collected in Eppendorf tubes to boil at 99āĀ°C for 10āmin. Two microliters of this lysate was transferred to a PCR reaction containing Platinum Taq buffer, Platinum Taq DNA polymerase, 50āmM MgCl2 (all Cat. #10966-034, Invitrogen), 10āmM dNTPs, forward (5ā² ā tggtgaaaccccgtctctac) and reverse (5ā²- ccgtttctggcaaacctatg) primers. The following conditions were set up for PCR: 10āmin 94āĀ°C, 35ācycles of 30āsec 94āĀ°C, 30āsec 61āĀ°C and 30āsec 72āĀ°C, then final extension for 10āmin 72āĀ°C. Two microliters of PCR product was used in BigDye Terminator v3.1 (Cat. #4337455, Applied Biosystems) Sanger sequencing reaction using the reverse primer. Sequences of single cell clones were compared with WT PAK2 sequence using TIDE analysis [21] to identify full PAK2 knock-out clones.
RNA isolation, cDNA conversion and qRT-PCR on cell line samples
Cell lines were grown to reach 70ā80% confluency and were harvested using trypsin. Cell pellets were snap frozen in liquid nitrogen and stored at āā80āĀ°C until RNA isolation. RNA was isolated using the NucleoSpin RNA kit according to manufacturerās protocol (Cat. #740955, Machery-Nagel) and quantified on a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). One microgram of RNA was converted into cDNA using the Superscript III reverse transcriptase kit according to manufacturerās protocol (Cat. # 18080085, Invitrogen). qRT-PCR was performed using SYBR green I (Cat. #4887352001, Roche) on a LightCyclerĀ® 480 II machine (Roche). Primer sequences were obtained from PrimerBank [22] or designed in house and are listed in the table below. All obtained Ct values were normalized to the expression of GUSB, results normalized to ATP5E were similar.
Gene | Forward | Reverse |
---|---|---|
PAK1 | 5ā² - AGGGGAGTTTACGGGAATGC | 5ā² - TCTTCTGCTCCGACTTAGTGATA |
PAK2 | 5ā² - CTGAGCTTTACTCCTCCTGAGA | 5ā² - GGGTGCTTCTGTTCCCTTGG |
PAK3 | 5ā² - CCAGGCTTCGCTCTATCTTCC | 5ā² - TCAAACCCCACATGAATCGTATG |
ARHGEF7 (Ī²PIX) | 5ā² - GCCAGTATCGGAGTTTGGACA | 5ā² - TTGGGAGGGCTCTTCAGTGT |
ATP5E | 5ā² - CCGCTTTCGCTACAGCAT | 5ā² - TGGGAGTATCGGATGTAGCTG |
GUSB | 5ā² - TGGTTGGAGAGCTCATTTGGA | 5ā² - GCACTCTCGTCGGTGACTGTT |
Western blotting
Lysates of all cell lines were generated from cultures grown to 70ā80% confluency. Cells were washed twice with ice cold PBS and lysed in 2x Laemmli buffer plus 10% Ī²-mercaptoethanol and 1x Haltā¢ protease/phosphatase inhibitor cocktail (Cat. #78440, Thermo Fisher Scientific) and scraped from the culture dish. Lysates were collected in Eppendorf tubes, boiled for 10āmin at 95āĀ°C and centrifuged at 4āĀ°C at maximum speed for 10āmin to remove remaining cell debris. Protein concentration was determined using the Protein Quantification Assay (Cat. #740967, Macherey-Nagel) before loading 20āĪ¼g of protein onto 4ā15% Mini-PROTEANĀ® TGXā¢ Precast Gels (Cat. #4561086 and #4561036, Bio-Rad laboratories). Before proceeding with blotting for PAK1 and PAK2 expression in the whole cell lysate of WT CMS2 and CMS4 Sanger cell lines, the polyacrylamide gel was incubated for 15āmin in electrophoresis buffer containing 1% 2,2,2-Trichloroethanol (Cat. #T54801, Sigma-Aldrich) to allow for tryptophan visualization and thereby comparison of amount of protein loaded between cell lines [23]. Gel was imaged using the UV sample tray of a Gel Dox EZ system (Bio-Rad Laboratories).
Protein was transferred using the Trans-BlotĀ® Turboā¢ RTA Mini PVDF Transfer Kit (Cat. #1704272, Bio-Rad Laboratories). Membranes were blocked in 5% bovine serum albumin in TBSā+Ā 0,1% Tween-20 (Sigma-Aldrich) for 1āhr. and subsequently probed overnight at 4āĀ°C with primary antibody diluted in blocking buffer under light agitation.
Primary antibodies used: PAK1, 1:1000, Cat. #2602; PAK2, 1:1000, Cat. #2608; phospho-Cofilin (Ser3), 1:2000, Cat. #3313S; Cofilin, 1:5000, Cat. #5175S (all Cell Signaling Technology) and GAPDH, 1:5000, Cat. #MAB374/6C5 (Merck/Millipore). The following secondary antibodies were diluted in 5% bovine serum albumin in TBSā+Ā 0,1% Tween-20: goat-Ī±-rabbit-IgG-HRP, 1:5000, Cat. #7074 (Cell Signaling Technologies) and goat-Ī±-mouse-IgG-HRP, 1:5000, cat. #1031-05 (SouthernBiotech, Birmingham, AL, USA). Blots were imaged using Lumi-LightPLUS western blotting substrate (Cat. #12015196001, Roche) on an ImageQuantā¢ LAS 4000 machine (GE Healthcare, Chicago, IL, USA). All in between washing steps were performed with TBSā+Ā 0,1% Tween-20. Quantification of Western blot images was performed as previously described [24].
Flow cytometry
Cells were harvested with trypsin and made single cell prior to FACS assays. All sorting experiments using FACS were performed on a BD FACS ARIAā¢ II SORP Cell Sorter (BD Biosciences). All FACS analysis experiments were performed on a BD FACSCantoā¢ II (BD Biosciences). Unstained or untransduced wildtype (WT) cells functioned as negative controls. 7-AAD (Cat. #559925, BD Biosciences) at a 1:100 dilution was added to samples to exclude dead cells. FACSDiva v8 software was used to acquire data, data analysis was performed with FlowJo software.
For the Nicoletti assay, 190,000 (HuTu-80) and 125,000 (MDST8) cells were plated per well of a 6 well plate. Medium was collected and combined with cells harvested using trypsin 48āhr. later. Cells were pelleted, taken up in freshly prepared Nicoletti buffer (50āĪ¼g/ml propidium iodide, 0.1% sodium citrate and 0.1% Triton X-100 in ddH2O) and left at 4āĀ°C overnight before analysis on BD FACS Canto II.
Cell viability assays
The proliferative capacity of PAK2 knock-out clones compared to wildtype cell lines was performed by seeding cells in a 96 well plate at a density of 80 cells per well in 100āĪ¼L medium on plastic (Fig.Ā 3B; Supplementary Fig. S2C) or at 80 cells per well in 6āĪ¼L Matrigel (Corning) drops in 100āĪ¼L medium (Fig. 3D; Supplementary Fig. S2D). All experiments were performed in 12 technical replicates and 3 biological replicates. Four hour after plating, a baseline CellTiter Glo (Cat. #G7571, Promega) measurement was included (day 0), the remaining plates were measured 4ādays and 7ādays after plating. All measurements were performed according to the manufacturerās protocol.
The effect of FRAX597 on the HuTu-80 and MDST8 cell lines as well as the p11t and p26t human organoids in Matrigel was assessed by plating 300 (HuTu-80), 150 (MDST8) or 1500 (p11t and p6t) cells per well in 6āĪ¼L Matrigel (Corning) drops in 100āĪ¼L medium, DMSO control, or medium containing increasing concentrations of FRAX597 (Cat. #S7271, SelleckChem, MĆ¼nchen, Germany). All experiments were performed in 6 technical replicates and 3 biological replicates. Four hours after plating, a baseline CellTiter Glo (Cat. #G7571, Promega) measurement was included (day 0), the remaining plates were measured 4ādays after plating. All measurements were performed according to the manufacturerās protocol.
The FRAX597 sensitivity assay was executed by seeding cells in 100āĪ¼L medium in a 96 well cell tissue culture plate and treating cells in triplicate with DMSO or a titration of FRAX597. The drug titration was printed using a HP D300e Digital Dispenser (Hewlett-Packard, Palo Alto, CA, USA). The number of cells plated per well were 4000 for HT55 and 1000 for HuTu-80 and MDST8. Cell proliferation was measured using the IncuCyte S3 (Sartorius, Gƶttingen, Germany). Images were acquired every 6āhours for 72āhours starting 1āhour after plating. Data analysis and quantification was performed using the IncuCyte Base Analysis Software. Experiments were performed in 3 technical replicates and 3 biological replicates.
The chemotherapy sensitivity assay was performed by seeding 80 cells per well in 100āĪ¼L medium in a 96 well cell tissue culture plate and treating cells in triplicate with DMSO or a titration of Oxaliplatin, 5-FU or Paclitaxel. The drug titration was printed using a HP D300e Digital Dispenser (Hewlett-Packard, Palo Alto, CA, USA). Cell viability was measured 4āhours after plating, as a day 0 baseline measurement, and 3ādays after treatment using CellTiter Glo (Cat. #G7571, Promega) according to the manufacturerās protocol. All experiments were performed in 3 technical replicates and 3 biological replicates.
Immunohistochemistry
Per animal, three cross-sections of separate areas from the liver and one cross-section from the lungs were derived from FFPE material obtained in the mesenteric vein injection experiments. Sections were stained with a human-specific Ku80 antibody (C48E7, cat. #2180, Cell Signaling) and counterstained with hematoxylin by the NKI animal pathology department to accurately detect micro- and macro-metastases. Slides were scanned on an Aperio AT2 slide scanner (Leica). Metastatic burden was quantified in ImageJ as follows; first channels were separated by Color Deconvolution (vectorsā=ā[H&E DAB]), next the total tissue area was determined on channel 1 (hematoxylin) after application of a Gaussian Blur and AutoThreshold, lastly the number and area of all individual foci was measured on channel 3 (DAB) after application of a Gaussian Blur and AutoThreshold using the Analyze Particles function.
Clonogenic assay
The clonogenic assay for Ī²PIX targeting shRNA transduced cells was quantified using crystal violet as previously described [25]. Briefly, following lentiviral transduction with pLKO.1 non-silencing and Ī²PIX targeting shRNAs and puromycin selection, an equal number of cells were plated for each condition in a 24 well plate in triplicate. After 48āhours cells were washed twice with PBS and a mixture of 500āĪ¼L 6.0% glutaraldehyde and 0.5% crystal violet was added per well. Cells were incubated at RT for 30āmin after which the solution was removed. The plates were rinsed with tap water and left to dry overnight. Visualization of the plates was obtained with an HP Scanjet 4850 scanner. Quantification was performed by dissolving the crystal violet stained cells in 300āĪ¼L PBS containing 1% sodium dodecyl sulfate (SDS) per well for 1āhr. at RT on a shaker. The absorbance was then read on a SynergyTM HT multi-detection microplate reader (BioTek Instruments) at 570ānm wavelength.
Immunofluorescence
An equal number of cells per condition were plated on top of glass coverslips in a 12 well plate. After 24 or 48āhr. of incubation, the medium was removed and cells were washed with PBS twice followed by fixation with 4% PFA for 10āmin. The PFA was then removed and the cells were washed twice with PBS. Before staining, cells were permeabilized for 10āmin using 1% Triton X-100 (Thermo Fischer) diluted in PBS. Next, samples were blocked using 5% Normal Goat Serum (Cat. # ab7481, Abcam) and 0,1% Triton X-100 in PBS for 30āmin. Primary antibodies were diluted in BrightDiluent green antibody diluent (Cat. #UD09ā999, Immunologic) according to manufacturerās protocol and incubated overnight at 4āĀ°C. The samples were washed twice with PBS and incubated in secondary antibody for 1āhr. at RT covered. Next, Hoechst-33,341 (Cat. #62249, Thermo Fischer) was used as a nuclear counterstain and incubated at 10āĪ¼g/ml in PBS for 5āmin at RT. For the actin staining, samples were incubated after the permeabilization step with ActinRedā¢ 555 ReadyProbesā¢ Reagent (R37112, Thermo Fischer) according to manufacturerās protocol, Hoechst-33,341 was also used as nuclear counterstain for these slides. The coverslips were then mounted with Prolong Gold antifade reagent (Cat. #P10144, Invitrogen) on glass slides. All stainings were analyzed with the SPSX8 confocal microscope (Leica) and stored at 4āĀ°C. The following antibodies were used: anti-human vimentin (1:300; sc-73,259, Santa Cruz), anti-human Ī²-tubulin (1:200; T7816/SAP.4G5, Sigma), anti-mouse Alexa Fluor 488 (1:500, A11029, Invitrogen).
TIRF Lifeact/paxillin imaging and analysis
Lifeact-GFP and Paxillin-mCherry transduced MDST8 and HuTu-80 WT and PAK2-KO cells were plated on Lab-Tek chambered 1.0 borosilicated coverglass slides and cultured in SILAC DMEM Flex Medium (Cat. #A2493901, ThermoFischer) supplemented with 8% FBS, 1% D-glucose solution plus), 1āmM sodium, 0,5% glutamine solution and 50āunits/mL of penicillin/streptomycin prior to imaging. For TIRF microscopy, an inverted NIKON Eclipse TI equipped with a 60āĆā1.49 NA Apo TIRF (oil) objective, perfect focus system, Argon Ion Laser 457ā514ānm (Melles Griot), Orange Diode Solid State Laser 594Ā nm 30Ā mW (Excelsior, Spectra-physics), dual band 488/594Ā nm TIRF filter cube (Chroma TRF59905 ET), and an Andor Zyla 4.2 plus sCMOS camera (without binning) was used. An Okolab cage incubator and humidified CO2 gas chamber set to 37āĀ°C and 5% CO2 were used during the imaging process, as described before [26]. Image acquisition was performed every 30āseconds for 1ā3āhr. total.
Invasion and migration assay
In vitro cell invasion of MDST8 and HuTu-80 WT or PAK2-KO cell lines was measured using the Corning BioCoat Matrigel Invasion Chamber assay (Cat. #354480, Corning) with 8.0āĪ¼m PET membrane, at 48āhr. post seeding. In vitro cell migration of primary spheroid lines was measured using the Corning 8.0āĪ¼m Pore Polycarbonate Membrane inserts (Cat. #3422, Corning). An equal amount of cells for each condition was plated in serum-free medium (DMEM/F12 or RPMI) in the upper chambers. Culture medium containing 10% FCS was used in the lower chamber as a chemoattractant. After incubation for 48āhr. for the cell lines and 72āhr. for the primary lines at 37āĀ°C, the medium was removed from the upper and lower chambers. The cells were fixed for 10āmin with 4% paraformaldehyde, rinsed with PBS and the non-migrated cells plus coating were removed from the upper chamber. The migrated cells were stained using crystal violet solution (see above) for 30āmin and then rinsed with tap water. The stained migrated cells were imaged on a Leica DM6 fluorescence microscope. Captured images were analyzed and quantified using Image J (ImageJ v1.50i, National institute of Health) and MATLAB software Briefly, crystal violet stained cells were identified as connected areas of positive pixels (intensity above manually chosen threshold) of a minimum size, to exclude background noise from filter pores or debris. Amount of crystal violet positive cells in this thresholded image were quantified in MATLAB for WT, NS, PAK2-KD and PAK2-KO images as the ratio of crystal violet positive cells on the total membrane area.
In vivo experiments
All mouse experiments were approved by animal experimentation committees at the respective institutes and performed according to institutional and national guidelines. Experiments were carried out at the following institutes, under the listed nationally registered license numbers: (i) subcutaneous injections, University of Palermo, D.L. number 26 March 4th 2014, 154/2017-PR; (ii) intraperitoneal injections, Academic Medical Center (AMC), AVD118002016493; (iii) mesenteric vein injections, Netherlands Cancer Institute (NKI), AVD3010020172464. All mice were housed in temperature-controlled facilities (20ā24āĀ°C) at 40ā70% humidity with a 12āh dark/light cycle and ad libitum access to food and water. Animals were sacrificed in accordance with Directive 2010/63/EU guidelines (D.lgs 26/2014). Mice were randomly assigned to experimental groups, experiments and analysis were not blinded, except for quantification of metastatic liver colonization and secondary spread to the lungs for the mesenteric vein injection experiments. Sample sizes were determined based on previous studies with similar experimental designs [8, 11, 27].
Six week old male NOD-SCID mice were purchased from Charles River Laboratories and subcutaneously injected with 1ā¢106 viable cancer cells suspended in 100āĪ¼L 2% BSA in PBS before reaching 12āweeks of age. Mice were monitored and weighed and tumor size was measured using a digital caliper twice a week. Tumor volume was calculated using the formula (smallest diameter)2 ā¢ largest diameter ā¢ Ļ/6. Mice were sacrificed once one of the following endpoints was met: (i) tumor volume of ā„2ācm3 or (ii) humane endpoint, mouse suffering as indicated by eg. weight loss or impaired movement of hind leg due to position of the tumor.
The experimental set-up to assess peritoneal metastatic potential of CRC cell lines was extensively described before [11]. Female Hsd:Athymic Nude-Foxn1nu mice (6ā12āweeks old, Envigo) were injected intraperitoneally with 1ā¢104 CRC cells suspended in a cold 50% Matrigel ā 50% culture medium solution of 100āĪ¼l volume. Mice were monitored and weighed twice a week and sacrificed 6 (MDST8) or 7āweeks (HuTu-80) post-injection to derive the peritoneal cancer index (PCI). No severe discomfort (eg. >ā15% weight loss within 2ādays) was observed during these studies.
The mesenteric vein injection model was described before [27]. Eight to fourteen weeks old male NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG, Cat. #005557, The Jackson Laboratory) mice were injected with 5ā¢104 WT HuTu-80-Dendra2 cells, PAK2-KO HuTu-80-LeGO-tdTomato cells or a 50:50 mixture of these two lines for a total of 5ā¢104 cells suspended in 100āĪ¼l PBS. Six mice were used for the WT condition, five for the other two. One mouse dropped out prematurely in the WT and WT-KO mixed condition, shortly after surgery. One mouse was mis-injected in both the WT and KO group. All 4 remaining animals in each group were sacrificed 28ādays post-injection. Livers and lungs were excised and fluorescent Dendra2 and tdTomato signal was imaged macroscopically on an AxioZoom.V16 (Zeiss), using a Plan-neofluar Z 1.0x/0.25 FWD 56āmm objective and a Monochome Axiocam 503 camera. Pieces of livers and lungs were formalin-fixed, paraffin-embedded (FFPE) and snap frozen for further microscopic quantification of tumor burden.
Results
A CRISPR-CAS9 drop-out screen reveals unique essential kinases for the CMS of CRC
To identify subtype-specific vulnerabilities, a CRISPR-Cas9-based drop-out screen, specifically targeting the kinome was performed. This set-up was aimed at identifying which kinases are essential for survival or proliferation of a cell line by tracing the abundance of a given guide RNA (gRNA) in the population over the course of 9 cell divisions (Fig.Ā 1A). To discriminate between subtypes, a defined set of 14 CRC cell lines representing each CMS and harboring various CRC driver mutations was used (Fig. 1B). The focus on the kinome was inspired by the fact that a wide selection of small molecules is available to inhibit this class of proteins, thereby enhancing the chances of uncovering clinically actionable targets. The analysis revealed that knock-out of several kinases resulted in a general drop-out in all lines and these related mostly to regulation of cell cycle, transcription or translation, such as CHEK1, CDK1, WEE1 and PLK1 (Supplementary Table S2). Subsequently, cell lines were grouped using the CMS annotation of all 14 lines and a comparison was made between the subtypes. Intriguingly, all CMSs contained essential kinases that dropped-out in a subtype specific manner (Fig. 1C). A relatively large number of kinases proved to be essential for survival and/or growth of the epithelial subtypes CMS2 and CMS3. This subtype selectivity did not appear to directly relate to CMS-specific expression of the kinases as analysis of mRNA expression levels of the top 2 kinase drop-outs per CMS showed a relatively stable expression across the subtypes both in cell lines (Fig. 1D) and tumor samples (Fig. 1E). This suggested that subtype-specific differences in sensitivity were the result of differential usage of the kinases and confirmed that the subtypes do display biologically distinct wiring.
CMS4 cancer cells are uniquely sensitive to PAK2 loss
The mesenchymal subtype CMS4 is characterized by therapy resistance as well as a more aggressive nature with a higher propensity to metastasize [4]. To validate the findings of the drop-out screen and to identify pathways crucial for the aggressive CMS4 cancers, drop-outs for the CMS4 cell lines were chosen for further study. Ten kinases with a significantly higher drop-out rate in CMS4 were identified (Fig. 1C). Among these is AKT3, which we recently identified as a driver of CMS4 outgrowth following identification by a bioinformatical pipeline [24]. Closer analysis of these 10 hits on the individual cell line level singled out PAK2 as the lead hit for CMS4 (Supplementary Table S2). The sensitivity to loss of PAK2 was, unlike the other 9 candidates, unique to CMS4 cell lines and evident in all but one of the CMS4 lines included in the screen.
PAK2 is a member of the group I PAK family (comprised of PAK1ā3), and closely related to the group II PAK family members, PAK4ā6 [28]. PAK2 serves a role downstream of Rho GTPases RAC and CDC42 and is involved in actin cytoskeleton remodeling, but also has a reported role in centrosome activity and membrane blebbing during apoptosis [29, 30]. Intriguingly, no sensitivity to loss of any of the other PAK family members was observed in CMS4 lines (Fig. 2A), neither to PAK2ās distant relatives PAK4ā6, nor to its closer relatives PAK1 and PAK3, further highlighting the unique role of PAK2 in the mesenchymal CRC subtype. Analysis of PAK family gene expression in tumors and cell lines showed that this subtype-specific sensitivity to loss of PAK2 could not be attributed to differential expression of other PAK family members (Fig. 2B; Supplementary Fig. S1A-D). To understand the dependency of mesenchymal CRC cell lines on PAK2, a direct comparison was made between the two most distant subtypes, being the epithelial subgroup CMS2 and the mesenchymal subgroup CMS4. First, analysis of protein expression levels confirmed the observation on the mRNA level and indicated that PAK2 sensitivity was not linked to overabundant PAK2 expression in CMS4 lines used in the screen (Fig. 2C). Second, an independent validation of the CMS4 dependency on PAK2 was performed using shRNA mediated knockdown in a competition assay in which wildtype (WT) cells were co-cultured with PAK2 knockdown cells (PAK2-KD) and the contribution of knockdown cells to the total population was followed over time (schematic overview in Fig. 2D). Effective knockdown of PAK2 was observed in all doxycycline-induced turboRFP+-shRNA+ cell lines (Supplementary Fig. S1E), while off-target or compensatory expression changes in PAK1 were negligible across cell lines (Supplementary Fig. S1F). The competition assay confirmed that PAK2-KD cells were specifically lost from the population in CMS4 cell lines in a time-dependent fashion, whereas growth of CMS2 PAK2-KD cell lines was unaffected (Fig. 2E). PAK2 sensitivity was extended to two additional CMS4 cell lines not included in the original CRISPR-Cas9 drop-out screen, pointing to a more general dependency of mesenchymal lines on this kinase (Supplementary Fig. S1G, H). Importantly, use of a PAK1/2/3 inhibitor, FRAX597, indicated that CMS4 lines were clearly more sensitive to inhibition of this family of kinases compared to CMS2 lines, suggesting that the PAK2 dependency also translates into sensitivity towards a chemical inhibitor (Fig. 2F).
PAK2 is essential for CMS4 tumor growth
To mimic complete loss of PAK2, as achieved in the drop-out screen, PAK2 CRISPR-Cas9 knock-out (KO) clones were generated for HT55 (CMS2) and HuTu-80, MDST8 and OUMS-23 (CMS4) (Fig. 3A; Supplementary Fig. S2A). In line with the drop-out screen and shRNA validation, in vitro outgrowth was impaired in CMS4 lines upon loss of PAK2, perhaps best exemplified by the observation that OUMS-23 PAK2 KO cultures crashed rapidly and could not be maintained in culture (Supplementary Fig. S2B). The other two CMS4 lines displayed reduced outgrowth in 2D cultures (Fig. 3B; Supplementary Fig. S2C) and even stronger impact in Matrigel-based 3D culture conditions (Fig. 3C, D; Supplementary Fig. S2D), which reportedly better mimics the in vivo setting. Vice versa, CMS2 cells were not affected in their outgrowth when deficient for PAK2 (Fig. 3B-D; Supplementary Fig. S2C, D). It has been previously reported that CMS2 and CMS4 cell lines are differentially sensitive to chemotherapy [8]. To explore if loss of PAK2 would result in increased sensitivity to commonly used chemotherapy in CRC, CMS2 and CMS4 WT and PAK2 KO cultures were treated with 5-fluoruracil (5-FU) and Oxaliplatin, Deletion of PAK2 did not result in significantly increased response efficiency for either of the drugs, neither in CMS2 nor in CMS4 lines (Supplementary Fig. S2E, F). The effect of Paclitaxel, a microtubule stabilizing drug [31], was also tested in WT and PAK2 KO cell lines. It was hypothesized that since PAK2 is involved in actin cytoskeleton remodeling and apoptosis [29, 30], this would result in increased sensitivity to Paclitaxel in combination with loss of PAK2. Similar to the response to 5-FU and Oxaliplatin, PAK2 KO cell lines did not show increased sensitivity to Paclitaxel (Supplementary Fig. S2G). Next, the effect of the PAK1/2/3 inhibitor FRAX597 was also measured in CMS4 cells in the 3D culture setting to further study its potential as a targeted treatment for this subtype. Both HuTu-80 and MDST8 were highly sensitive to FRAX597 at low doses in this setting (Fig. 3E). Importantly, CMS4 organoids derived from patient tumor samples were likewise strongly affected by PAK inhibition, indicating that this is a general CMS4 dependency (Fig. 3F). This dependency was not only evident in vitro but extended to in vivo tumor growth upon subcutaneous injection, which was completely impaired for MDST8 and significantly delayed for HuTu-80. In contrast, the epithelial CMS2 line HT55 was not dependent on PAK2 for subcutaneous tumor growth (Fig. 3G, H), emphasizing the relevance of our findings for tumor growth in vivo.
PAK2 affects actin cytoskeletal remodeling in CMS4 cell lines
Next the mechanism underlying the selective dependency of CMS4 on PAK2 was investigated. Previously, it was reported that caspase-cleaved active PAK2 is involved in the onset of apoptotic blebbing during apoptosis, while full length PAK2 was shown to prevent apoptosis by phosphorylating BAD and inhibiting caspase 3/7 activation [32,33,34]. Despite this role in regulating apoptosis, no overt difference in apoptotic rates were observed for the PAK2 KO cells, suggesting that cell death variation did not significantly contribute to the differences in growth rate (Supplementary Fig. S2H). A more concrete lead for the impact of PAK2 loss was evident from the bright field images of the PAK2 KO lines, which showed significant changes in the cellular shape with a more flattened morphology as compared to the wildtype cells (Supplementary Fig. S2I). This pointed to a role for PAK2 in cellular shape and potentially cytoskeletal rearrangements in CMS4 lines. Coinciding with this notion, inspection of a publicly available database of large CRISPR-based genetic screens (DEPMAP/PICKLES [35, 36]) unveiled a clear association between sensitivity to loss of PAK2 and loss of its binding partner Ī²PIX (ARHGEF7) across a large panel of pan-cancer cell lines. This interaction between Ī²PIX and PAK2 is reported to regulate actin cytoskeleton remodeling, focal adhesion (FA) disassembly and as a consequence migration [37, 38]. To determine whether the selective dependency of CMS4 cell lines would extend to Ī²PIX, its expression was knocked down in CMS4 and CMS2 lines. Strikingly, Ī²PIX knockdown also strongly reduced outgrowth of CMS4 cell lines, while the CMS2 line HT55 was insensitive to reduced Ī²PIX expression (Fig.Ā 4A, B; Supplementary Fig. S3A). This again confirmed the unique requirement of mesenchymal CRC lines for a Ī²PIX/PAK2-dependent pathway and suggested that scaffolding of PAK2 at the membrane by Ī²PIX is important in CMS4 outgrowth. Direct evidence for a role in cytoskeletal remodeling came from stainings for different filament networks. Both microfilaments (vimentin) and microtubules (tubulin) were comparable between PAK2 proficient and deficient cells. In contrast, intermediate filaments (actin) were significantly changed as indicated by a reduced amount of filopodia, increased deposition of actin at the membrane and an apparent increase in stress fibers in the PAK2 KO lines (Fig. 4C). To determine the dynamics of actin cytoskeleton remodeling and FA location in the absence of PAK2, CMS4 lines were transduced with LifeAct-GFP and Paxillin-mCherry and used for total internal reflection fluorescence microscopy (TIRF) imaging. Consistent with the phalloidin staining, TIRF imaging showed that PAK2 KO cells contained significant amounts of stress fibers with actin fibers concentrated at the cell membrane. The real-time analysis also captured the striking changes in filopodia dynamics with protrusions appearing at high frequency with a rapid turnover in WT cells, whereas they were strongly reduced and less abundant with slower turnover in PAK2-KO cells. Concurrently, lamellipodia were more evidently detected in the KO cells. The inclusion of paxillin-mCherry during filming revealed that the differences in actin distribution and dynamics at the membrane was related to the localization of FA in WT and PAK2 KO cells. FA were concentrated at the very edge of the membrane in WT cells connected to filopodia formation, whereas actin protruded well beyond the FA positions in PAK2 KO cells forming lamellipodia (Fig. 4D, E; Supplementary Fig. S3B-E; Supplementary Movies S1, S2, S3, S4, S5 and S6, available online).
Active cytoskeletal remodeling is regulated by an interplay between actin severing and depolymerization controlled by cofilin and filament extension via profilin. Cofilin activity is indirectly controlled by PAK1 and PAK2 via LIM kinase (LIMK) through phosphorylation [39]. Strikingly, phosphorylated cofilin levels were significantly increased in PAK2-KO cells as compared to WT cells (Fig. 4F), which correlates with the cytoskeletal phenotype observed: a less dynamic actin cytoskeleton with reduced filopodia formation, a shift in the localization of FA as well as the emergence of lamellipodia and stress fibers. Taken together, these differences illustrate that CMS4 cell lines require PAK2 to orchestrate actin cytoskeleton remodeling for the rapid emergence and turnover of filopodia, which are key structures for cancer cell invasion [40].
PAK2 deficient CMS4 cell lines lack invasive and metastatic capacity
The observation that CMS4 cell lines depended on both PAK2 and Ī²PIX in combination with the clear impact on actin cytoskeleton dynamics, suggested that the reduction in outgrowth in the subcutaneous injection model was the result of disturbed attachment. To better investigate the functional consequences of these changes, the invasive capacity of CMS4 cells proficient and deficient for PAK2 was analysed. When plated on extracellular matrix coated transwells, CMS4 lines effectively invade through the Matrigel whereas CMS2 cell lines failed to invade through the matrix (data not shown). Intriguingly, PAK2 KO CMS4 cells completely lost this invasive capacity (Fig.Ā 5A, B), indicating that an activated PAK2 pathway endows MDST8 and HuTu-80 cells with migratory and invasive capacity. Similarly, primary CMS2 and CMS4 lines were generated in which PAK2 could be knocked down using a doxycycline-inducible shRNA system. PAK2 expression was clearly decreased upon knockdown compared to a non-silencing control (Supplementary Fig. S4A). As these cells grow in suspension, the impact of PAK2 knockdown on growth was not evident (Supplementary Fig. S4B). However, a clear decrease in migration through a transwell upon PAK2 knockdown was detected for the CMS4 line CONC. As reported before CMS2 lines did not display evident migration, suggesting that also primary CMS4 CRC lines were endowed with migratory capacity, which depended on the activity of PAK2 (Supplementary Fig. S4C, D). Based on these observations it is tempting to speculate that mesenchymal CRC cells, may depend on this pathway for metastasis. Previously, we reported that CRC that belong to CMS4 have a high propensity to metastasize to the peritoneal cavity, liver and lung [4, 11, 13]. To assess the impact of PAK2 deficiency on metastatic spreading of CMS4 directly, an intraperitoneal metastasis model for CRC was employed (Fig. 5C). This method previously showed high numbers of metastases with CMS4, but not CMS2 lines [11, 13]. Interestingly, PAK2 KO CMS4 lines failed to grow in the peritoneal cavity and thus failed to form metastases, while the WT counterparts efficiently induced multiple metastases, in line with the observation that PAK2 is required for outgrowth and invasion in an in vitro 3D setting (Fig. 5D). Similarly, mesenteric vein injection (Fig. 5E) of WT Dendra-labelled HuTu-80 cells displayed efficient colonization and growth of multiple metastatic foci in the liver and, due to its aggressive nature, also induced secondary seeding from the liver to the lungs with a large number of small metastases present after 4āweeks. In contrast, tdTomato-labelled PAK2 KO HuTu-80 cells were significantly less effective in forming liver metastases and almost completely failed to reseed to the lung. The limited amount of PAK2 KO cells that were detected in the lungs remained as single cells in contrast to the WT cells that grew out to form macrometastases (Fig. 5F-I; Supplementary Fig. S4E). Additionally, when injected together with WT cells, the PAK2 KO cells had a clear defect in primary and secondary seeding to metastatic sites, further proving that PAK2 was essential for the metastatic spreading of mesenchymal CRC cells to distant sites (Supplementary Fig. S4F).
Discussion
We have shown that CRC subtypes are wired differently and contain unique subtype-specific vulnerabilities with the application of a CRISPR-Cas9 drop-out screen. Validation of the most significant drop-out in the mesenchymal subtype CMS4, PAK2, unveiled a dependency of this subtype on cytoskeletal remodeling. Moreover, loss of PAK2 hampered outgrowth, invasion and metastasis, key biological features associated with this subtype of CRC. The subtype selectivity of numerous kinases identified in the drop-out screen confirms earlier claims that CMS features can be traced to the epithelial tumor compartment [8, 10]. When scrutinizing the list of kinases identified in the screen, some expected kinases stand out. For instance, epithelial subtypes CMS2 and CMS3 are more dependent on EGFR than CMS1 and CMS4, which was shown before and further supports earlier clinical observations which suggest that CMS4 cancers do not respond to anti-EGFR therapy [41]. Similarly, AKT3 is defined as a CMS4-selective kinase, which confirms our previous findings using a bioinformatical pipeline [24]. However, most subtype-specific kinases will need more detailed mechanistic analysis to understand their selectivity, which is likely to reveal more subtype specific biological features. For PAK2, the selectivity is almost absolute as it is essential in the large majority of CMS4 lines, while it is dispensable in all tested CMS1/2/3 cell lines.
The role of PAK2 in CMS4 goes beyond survival or proliferation, which is typically revealed in a drop-out screen, as it is also crucial for regulation of signaling downstream of Ī²PIX and attachment, and its loss leads to altered actin cytoskeleton dynamics and ultimately to a lack of invasion and metastasis. Actin remodeling and dynamics necessary for cell migration and invasion are typically regulated by Rho family GTPases. Briefly, activated RHO enhances stress fiber formation, RAC induces lamellipodia formation and CDC42 stimulates filopodia [42, 43]. This suggests that deletion of PAK2 in CMS4 cells results in a shift towards RHO activity, which is in line with earlier observations that indicate that PAK activity acts downstream of RAC/CDC42 to phosphorylate and inactivate GEF-H1, a guanine nucleotide exchange factor (GEF) for RhoA [28]. Deletion of PAK2 could break this GEF inhibitory effect, activating RhoA and allowing for RhoA-induced stress fiber formation, which could provide a model for the observed phenotypical differences in actin cytoskeleton dynamics.
Clearly, the drop-out screen results indicated that PAK1 and PAK2 are not interchangeable. Earlier work also revealed clear differences between these seemingly highly similar kinases [44]. For instance, PAK1 cannot substitute for the pro-apoptotic role exerted by PAK2 [45]. In addition, PAK2 was shown to localize to focal adhesions, while PAK1 displayed a more cytosolic staining. Under these conditions, PAK2 was suggested to mediate attachment, while PAK1 was involved in spreading [45]. In CMS4 lines it is evident that deletion of PAK2 increases cofilin phosphorylation, which lowers its actin-severing activity and thus coincides with the observed decrease in actin turnover and the relatively more stable stress fibers. Importantly, inhibition of growth appeared to depend on the necessity of cells to grow in attachment and was less evident for the primary lines that grow in suspension. Nevertheless, the impact on migration and invasion, which is a crucial first step in metastasis, was apparent in both PAK2 deficient CMS4 cell lines and primary cells and was absent from their CMS2 counterparts. This process has been reported to require active actin cytoskeleton remodeling and is directly related to RAC/CDC42 activity and downstream signaling [46]. Although the exact orchestration of this signaling pathway in CMS4 requires additional mechanistic insight, the consequences of PAK2 deletion are highly significant as a near complete inhibition of in vivo growth and metastasis was observed in multiple models. Moreover, inhibition of PAK group 1 family kinases using FRAX597 confirmed this higher dependency of CMS4 lines and organoids on PAK signaling. Combined, our data therefore highlight the potential of PAK2 as a novel target for therapy; either by preventing invasion to and colonization of metastatic sites, by preventing outgrowth of single cell metastases, or by a combined effect. Unfortunately, the only inhibitors available target all members of the PAK family I, while the current data point out that targeting PAK2 suffices. Focusing treatment solely on PAK2 might diminish unwanted side effects, while effectively inhibiting the metastatic potential of the aggressive subtype CMS4.
Conclusions
In conclusion, we have identified PAK2 as a unique and selective essential kinase for outgrowth and metastasis of the mesenchymal subtype of CRC (CMS4) using in vitro and in vivo models. We suggest that PAK2 plays a key role in the actin cytoskeleton remodeling of CMS4 cell lines. Furthermore, we demonstrate that CMS4 cell lines and human-derived organoids are sensitive to the inhibition of PAK group 1 family kinases, suggesting a potential novel therapy for the poor-prognosis subtype of CRC.
Availability of data and materials
All data generated or analyzed during this study are included in this published article and its supplementary information files.
Abbreviations
- CRC:
-
Colorectal cancer
- CMS:
-
Consensus molecular subtype
- PAK2:
-
p21-activated kinase 2
- CIN:
-
Chromosomal instable
- MSI:
-
Microsatellite instable
- gRNA:
-
guide RNA
- WT:
-
Wildtype
- PAK2-KD:
-
PAK2 knockdown
- KO:
-
CRISPR-Cas9 knock-out
- FA:
-
Focal adhesion
- TIRF:
-
Total internal reflection fluorescence microscopy
- LIMK:
-
LIM kinase
- GEF:
-
Guanine nucleotide exchange factor
References
Fearon ER. Molecular genetics of colorectal cancer. Annu Rev Pathol. 2011;6:479ā507.
N. CGA. Comprehensive molecular characterization of human colon and rectal cancer. Nature. 2012;487(7407):330ā7.
Punt CJA, Koopman M, Vermeulen L. From tumour heterogeneity to advances in precision treatment of colorectal cancer. Nat Rev Clin Oncol. 2017;14(4):235ā46.
Guinney J, Dienstmann R, Wang X, de Reynies A, Schlicker A, Soneson C, et al. The consensus molecular subtypes of colorectal cancer. Nat Med. 2015;21(11):1350ā6.
Calon A, Lonardo E, Berenguer-Llergo A, Espinet E, Hernando-Momblona X, Iglesias M, et al. Stromal gene expression defines poor-prognosis subtypes in colorectal cancer. Nat Genet. 2015;47(4):320ā9.
Isella C, Terrasi A, Bellomo SE, Petti C, Galatola G, Muratore A, et al. Stromal contribution to the colorectal cancer transcriptome. Nat Genet. 2015;47(4):312ā9.
Buikhuisen JY, Torang A, Medema JP. Exploring and modelling colon cancer inter-tumour heterogeneity: opportunities and challenges. Oncogenesis. 2020;9(7):66.
Linnekamp JF, Hooff SRV, Prasetyanti PR, Kandimalla R, Buikhuisen JY, Fessler E, et al. Consensus molecular subtypes of colorectal cancer are recapitulated in in vitro and in vivo models. Cell Death Differ. 2018;25(3):616ā33.
Eide PW, Bruun J, Lothe RA, Sveen A. CMScaller: an R package for consensus molecular subtyping of colorectal cancer pre-clinical models. Sci Rep. 2017;7(1):16618.
Sveen A, Bruun J, Eide PW, Eilertsen IA, Ramirez L, Murumagi A, et al. Colorectal cancer consensus molecular subtypes translated to preclinical models uncover potentially targetable cancer cell dependencies. Clin Cancer Res. 2018;24(4):794ā806.
Bastiaenen VP, Klaver CEL, van der Heijden MCS, Nijman LE, Lecca MC, Tanis PJ, et al. A mouse model for peritoneal metastases of colorectal origin recapitulates patient heterogeneity. Lab Invest. 2020;100(11):1465ā74.
Jackstadt R, van Hooff SR, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA, et al. Epithelial NOTCH signaling rewires the tumor microenvironment of colorectal cancer to drive poor-prognosis subtypes and metastasis. Cancer Cell. 2019;36(3):319ā36 e7.
Lenos KJ, Bach S, Ferreira Moreno L, Ten Hoorn S, Sluiter NR, Bootsma S, et al. Molecular characterization of colorectal cancer related peritoneal metastatic disease. Nat Commun. 2022;13(1):4443.
van de Wetering M, Francies HE, Francis JM, Bounova G, Iorio F, Pronk A, et al. Prospective derivation of a living organoid biobank of colorectal cancer patients. Cell. 2015;161(4):933ā45.
Alieva M, Margarido AS, Wieles T, Abels ER, Colak B, Boquetale C, et al. Preventing inflammation inhibits biopsy-mediated changes in tumor cell behavior. Sci Rep. 2017;7(1):7529.
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.
Li W, Xu H, Xiao T, Cong L, Love MI, Zhang F, et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 2014;15(12):554.
Gautier L, Cope L, Bolstad BM, Irizarry RA. affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics. 2004;20(3):307ā15.
Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8(1):118ā27.
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281ā308.
Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014;42(22):e168.
Spandidos A, Wang X, Wang H, Seed B. PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 2010;38(Database issue):D792ā9.
Ladner CL, Yang J, Turner RJ, Edwards RA. Visible fluorescent detection of proteins in polyacrylamide gels without staining. Anal Biochem. 2004;326(1):13ā20.
Buikhuisen JY, Gomez Barila PM, Torang A, Dekker D, de Jong JH, Cameron K, et al. AKT3 expression in mesenchymal colorectal cancer cells drives growth and is associated with epithelial-mesenchymal transition. Cancers (Basel). 2021;13(4):801
Franken NA, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc. 2006;1(5):2315ā9.
van der Stoel M, Schimmel L, Nawaz K, van Stalborch AM, de Haan A, Klaus-Bergmann A, et al. DLC1 is a direct target of activated YAP/TAZ that drives collective migration and sprouting angiogenesis. J Cell Sci. 2020;133(3):jcs239947.
Fumagalli A, Drost J, Suijkerbuijk SJ, van Boxtel R, de Ligt J, Offerhaus GJ, et al. Genetic dissection of colorectal cancer progression by orthotopic transplantation of engineered cancer organoids. Proc Natl Acad Sci U S A. 2017;114(12):E2357āE64.
Radu M, Semenova G, Kosoff R, Chernoff J. PAK signalling during the development and progression of cancer. Nat Rev Cancer. 2014;14(1):13ā25.
Whalley HJ, Porter AP, Diamantopoulou Z, White GR, Castaneda-Saucedo E, Malliri A. Cdk1 phosphorylates the Rac activator Tiam1 to activate centrosomal Pak and promote mitotic spindle formation. Nat Commun. 2015;6:7437.
Rudel T, Bokoch GM. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science. 1997;276(5318):1571ā4.
Horwitz SB. Taxol (paclitaxel): mechanisms of action. Ann Oncol. 1994;5(Suppl 6):S3ā6.
Eron SJ, Raghupathi K, Hardy JA. Dual site phosphorylation of Caspase-7 by PAK2 blocks apoptotic activity by two distinct mechanisms. Structure. 2017;25(1):27ā39.
Marlin JW, Eaton A, Montano GT, Chang YW, Jakobi R. Elevated p21-activated kinase 2 activity results in anchorage-independent growth and resistance to anticancer drug-induced cell death. Neoplasia. 2009;11(3):286ā97.
Jakobi R, Moertl E, Koeppel MA. p21-activated protein kinase gamma-PAK suppresses programmed cell death of BALB3T3 fibroblasts. J Biol Chem. 2001;276(20):16624ā34.
Lenoir WF, Lim TL, Hart T. PICKLES: the database of pooled in-vitro CRISPR knockout library essentiality screens. Nucleic Acids Res. 2018;46(D1):D776āD80.
Kim E, Dede M, Lenoir WF, Wang G, Srinivasan S, Colic M, et al. A network of human functional gene interactions from knockout fitness screens in cancer cells. Life Sci Alliance. 2019;2(2):e201800278.
Reddy PN, Radu M, Xu K, Wood J, Harris CE, Chernoff J, et al. p21-activated kinase 2 regulates HSPC cytoskeleton, migration, and homing via CDC42 activation and interaction with beta-Pix. Blood. 2016;127(16):1967ā75.
Hiroyasu S, Stimac GP, Hopkinson SB, Jones JCR. Loss of beta-PIX inhibits focal adhesion disassembly and promotes keratinocyte motility via myosin light chain activation. J Cell Sci. 2017;130(14):2329ā43.
van Rheenen J, Condeelis J, Glogauer M. A common cofilin activity cycle in invasive tumor cells and inflammatory cells. J Cell Sci. 2009;122(Pt 3):305ā11.
Jacquemet G, Hamidi H, Ivaska J. Filopodia in cell adhesion, 3D migration and cancer cell invasion. Curr Opin Cell Biol. 2015;36:23ā31.
Ten Hoorn S, Sommeijer DW, Elliott F, Fisher D, de Back TR, Trinh A, et al. Molecular subtype-specific efficacy of anti-EGFR therapy in colorectal cancer is dependent on the chemotherapy backbone. Br J Cancer. 2021;125(8):1080ā8.
Raftopoulou M, Hall A. Cell migration: rho GTPases lead the way. Dev Biol. 2004;265(1):23ā32.
Lawson CD, Ridley AJ. Rho GTPase signaling complexes in cell migration and invasion. J Cell Biol. 2018;217(2):447ā57.
Coniglio SJ, Zavarella S, Symons MH. Pak1 and Pak2 mediate tumor cell invasion through distinct signaling mechanisms. Mol Cell Biol. 2008;28(12):4162ā72.
Grebenova D, Holoubek A, Roselova P, Obr A, Brodska B, Kuzelova K. PAK1, PAK1Delta15, and PAK2: similarities, differences and mutual interactions. Sci Rep. 2019;9(1):17171.
Diring J, Mouilleron S, McDonald NQ, Treisman R. RPEL-family rhoGAPs link Rac/Cdc42 GTP loading to G-actin availability. Nat Cell Biol. 2019;21(7):845ā55.
Acknowledgements
The authors thank Sanne van Neerven for technical support with confocal imaging and Illustrator. Valerie Wouters for technical support with culturing of human organoids. Martin de Rooij for sharing insights regarding CRISPR-based screening. The flow cytometry facility at the Amsterdam University Medical Center for FACS sorting support. Paris Asif and Daniƫl Miedema for technical support with the invasion transwell assay and quantification of images, and all members of the LEXOR laboratory for helpful discussions and additional support.
Funding
This work was supported by the Koningin Wilhelmina Fonds Dutch Cancer Society (grants UVA2014-7245 and 10150) and Oncode Institute. L.V. is a New York Stem Cell Foundation ā Robertson Investigator. J.Y.B. was partially funded by the AMC Graduate School PhD Scholarship.
Author information
Authors and Affiliations
Contributions
JYB contributed to conceptualization, validation, formal analysis, investigation, data curation, writing-original draft preparation, writing-review and editing, visualization and funding acquisition. PMGB contributed to conceptualization, validation, formal analysis, investigation, data curation, writing-original draft preparation, writing-review and editing and visualization. KC contributed to validation, investigation and data curation. SJES contributed to investigation, writing-review and editing. CL contributed to software, validation, investigation and data curation. SdF contributed to investigation, writing-review and editing. AKG contributed to investigation, writing-review and editing. RUC contributed to investigation of the study. KJL contributed to investigation, writing-review and editing. LEN contributed to investigation of the study. AT contributed to investigation of the study. CL contributed to investigation of the study. JHdJ contributed to investigation of the study. DD contributed to the validation and investigation of the study. GS provided resources for the study. LV contributed to the conceptualization of the study, provided resources, writing-review and editing, and funding acquisition. RLB contributed to the conceptualization of the study, provided resources, writing-review and editing, and funding acquisition. JvR provided resources and contributed to the writing- review and editing. SH contributed to investigation, provided resources, writing-review and editing. JPM contributed to the conceptualization of the study, formal analysis, data curation, writing-original draft preparation, writing-review and editing, supervision and funding acquisition. All authors have read and agreed to the final version of the manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisherās Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1: Supplementary Fig. S1
. Validation of PAK2 as an essential kinase for CMS4 cell lines. A, PAK1ā3 mRNA expression levels in a panel of 28 CRC cell lines, also including those used for the drop-out screen, as determined by quantitative PCR. Of note: diamond for PAK3 located on x-axis indicates no mRNA could be detected in this sample. B, C, 2Log mRNA expression levels of PAK4ā6 in CRC cell lines (B) and tumors (C), determined by microarray or RNA sequencing. D, Western blot for PAK1 protein expression in HT55 & SW948 (CMS2) and HuTu-80 & MDST8 (CMS4). 2,2,2-Trichloroethanol (2,2,2TCE) signal (excerpt taken around 60ākDa region) indicates amount of protein loaded per cell line. Numbers on the left represent molecular weight in kDa according to a stained protein ladder loaded in the gel. Representative blot of NĀ =ā3 is displayed. E, F, PAK2 (E) and PAK1 (F) gene expression levels in cells expressing non-silencing (NS) or PAK2 targeting shRNA (PAK2-KD), as determined by qPCR. Expression was normalized to NS condition, NĀ =ā3, meanā+āS.D. is plotted. G, PAK2 gene expression levels in cells expressing non-silencing (NS) or PAK2 targeting shRNA (PAK2-KD), as determined by qPCR in CMS4 cell lines not included in the initial screen (CaR-1, LS123) and a CMS4 line in which PAK2 was not a significant drop-out in the initial screen (Colo320-HSR). H, Relative contribution of PAK2 KD cells to co-culture in competition assay set-up, over time, in additional CMS4 cell lines. Contribution of shRNA-turboRFP expressing cells was first normalized to contribution on day 0 post sort, and subsequently calculated relative to contribution of NS shRNA-turboRFP expressing cells at each individual time-point. NĀ ā„ā2, meanā+ās.e.m. is plotted. Supplementary Fig. S2. PAK2 loss alters cell morphology, not induction of apoptosis, of CMS4 cell lines. A, Validation of successful PAK2 knock-out (KO) in OUMS-23 CRISPR-Cas9-edited single cell knock-out clones. WTā=āwildtype. Numbers on the left represent molecular weight in kDa according to a stained protein ladder loaded in the gel. B, Phase contrast images of OUMS-23 WT and KO cells 7ādays post-plating. Region of interest (ROI) selected for lower panels is indicated in white dashed box. C, D, Outgrowth of WT and PAK2-KO cells plated on plastic (C) or Matrigel (D) relative to day 0, as measured 4ādays post-plating by CellTiter Glo. Representative experiment of NĀ =ā3 is shown. Data plotted is meanā+āS.D. N.S. = not significant, **ā=Ā PĀ <ā0.005, ***ā=Ā PĀ <ā0.001, ****ā=Ā PĀ <ā0.0001 in two-tailed, Welch-corrected Studentās T-test. E, F, G, Relative outgrowth of cells after 3ādays of treatment with different concentrations of Oxaliplatin (E), 5-FU (F) and Paclitaxel (G) measured using CellTiter Glo and normalized to DMSO treated control relative to a day 0 baseline measurement. Data plotted is meanāĀ±āS.D. Representative experiment of NĀ =ā3 is shown. H, Percentage of apoptotic cells present 48āhours post plating as assessed by Nicoletti assay. Bar graphs depict meanā+ās.e.m., NĀ =ā3, n.s. = not significant as calculated by two-tailed, Welch-corrected Studentās T-test. I, Phase contrast images of CMS2 (HT55) and CMS4 (HuTu-80, MDST8) WT and KO cells 5ādays post-plating. Scale bar represents 50āĪ¼m. Supplementary Fig. S3. PAK2 deficiency affects actin cytoskeleton turnover and focal adhesion localization. A, ARHGEF7 (Ī²PIX) gene expression levels in cells expressing non-silencing (NS) or ARHGEF7 (Ī²PIX) targeting shRNAs (Sh-1, Sh-2), as determined by qPCR. Expression was normalized to NS condition, NĀ =ā3, meanā+ās.d. is plotted. B, C, Region of interest stills (Fig. 4D) from time-lapse TIRF microscopy at indicated time points (minā=āminutes) of cell lines transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Scale bars indicate 5āĪ¼m. See corresponding Supplementary MoviesĀ 5and 6, available online, for the full time-lapse recording. D, E, Heatmaps show actin cytoskeleton dynamics over 60āminutes for HuTu-80 (D) and MDST8 (E) in a unique color per time frame. Note the rapid emergence and disappearance of filopodia in the WT condition and relative stability of filopodia over time in PAK2-KO cells. Supplementary Fig. S4. Metastatic colonization and secondary spread is strongly reduced by PAK2 loss. A, PAK2 gene expression levels in primary cultures expressing non-silencing (NS) or PAK2 targeting shRNA (PAK2-KD), as determined by qPCR. B, Relative outgrowth of NS or PAK2-KD primary cell lines plated on low-adherent culture plates relative to day 0, as measured 4ādays post-plating by CellTiter Glo.. Data plotted is meanāĀ±āS.D. Representative experiment of NĀ =ā3 is shown. C, D, Quantification (C) and representative images (D) of Migration Transwell experiments. Bar plots display relative area percentage covered by cells (purple) in Transwell image. Data plotted is meanāĀ±āS.D. Values representing NĀ =ā2 are plotted. E, Representative images of liver and lung sections stained for human Ku80 (DAB, indicated in brown), derived from two mice per condition. Along with the other Ku80-stained sections, these images were the source for quantification as included in Fig. 5G, I. F, Macroscopic images of tumor burden in full livers and lungs of mice injected with a 50ā50% mixture of HuTu-80 WT-Dendra (green) and PAK2-KO-tdTomato cells (magenta). Pictures were taken shortly after mice were sacrificed.
Additional file 2: Supplementary MovieĀ 1. Full time lapse recording of Hutu-80 WT vs. PAK2-KO cells. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording. Selected still images and further analysis from the full time-lapse recording are represented in Fig. 4D, E and Supplementary Fig. S4B-E.
Additional file 3: Supplementary MovieĀ 2. Selected ROI from full time lapse recording of Hutu-80 WT vs. PAK2-KO cells. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording. The ROI was selected from the full time-lapse recording shown in Supplementary MovieĀ 1.
Additional file 4: Supplementary MovieĀ 3. Full time lapse recording of MDST8 WT vs. PAK2-KO cells. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording. Selected still images and further analysis from the full time-lapse recording are represented in Fig. 4D, E and Supplementary Fig. S4B-E.
Additional file 5: Supplementary MovieĀ 4. Selected ROI from full time lapse recording of MDST8 WT vs. PAK2-KO cells. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording. The ROI was selected from the full time-lapse recording shown in Supplementary MovieĀ 3.
Additional file 6: Supplementary MovieĀ 5. Split channel recordings from full time lapse imaging of Hutu-80 WT vs. PAK2-KO cells. Split channel view of time lapse recording shown in Supplementary MovieĀ 2. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording.
Additional file 7: Supplementary MovieĀ 6. Split channel recordings from full time lapse imaging of MDST8 WT vs. PAK2-KO cells. Split channel view of time lapse recording shown in Supplementary MovieĀ 4. Cell lines were transduced with Lifeact-GFP (green) and paxillin-mCherry (magenta). Images were acquired every 30āseconds for 1ā3āhours by time-lapse TIRF microscopy (NIKON Eclipse Ti) with a 60x/1.49 NA oil objective. Time stamp indicates minutes passed since the start of the recording.
Additional file 8: Table S1
. Raw normalized sgRNA counts per sample per cell line of the CRISPR-Cas9 drop-out screen performed.
Additional file 9: Table S2.
Results from analysis of CRISPR-Cas9 drop-out screen representing the fold change within each replicate of sgRNA counts between t1 and t0.
Additional file 10.
Full Western blot membrane images represented in the manuscript.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Buikhuisen, J.Y., Gomez Barila, P.M., Cameron, K. et al. Subtype-specific kinase dependency regulates growth and metastasis of poor-prognosis mesenchymal colorectal cancer. J Exp Clin Cancer Res 42, 56 (2023). https://doi.org/10.1186/s13046-023-02600-9
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13046-023-02600-9