Cell culture
Two OSCC cell lines, human SCC-25 and CAL 27 were originally obtained from American Type Culture Collection (ATCC, USA). SCC-25 cells were cultured in 1:1 mixture of DMEM and Ham’s F12 medium supplemented with 500 ng/ml hydrocortisone and 20% fetal bovine serum. CAL 27 cells were cultured in DMEM medium supplemented with 20% fetal bovine serum. All cells were grown in a humidified 5% CO2 incubator at 37 °C.
Induction of OSCC tumors
40 Syrian golden hamsters (90-110 g in weight, half male and half female) obtained from Beijing Vital River Laboratory Animal Technology (China) were used in this study. Animals were randomly divided into four experimental groups, including group A (n = 8), B (n = 8), C (n = 8), D (n = 10), and one control group (n = 6). In four experimental groups, left cheek pouches of the animals were painted three times per week with 50 μl of 0.5% DMBA (Sigma-Aldrich) solution in acetone. Group A had undergone DMBA treatment for 4 weeks, group B for 7 weeks, group C for 10 weeks and group D for 14 weeks. The control group animals were painted with 50 μl of acetone solution alone for 14 weeks. All animals were housed at 22 °C, with standard 12-h light/dark cycles. Food and water were provided ad libitum. Animals were euthanized with CO2.
Histopathological diagnosis
All buccal pouches were examined and excised. For preparation of total RNA, one half of each harvested tissue was snap frozen in the liquid nitrogen and then transferred to −80 °C refrigerator to save. Another half of each tissue was immediately fixed in 10% formalin and paraffin-embedded for histopathological diagnose. Sections underwent standard hematoxylin and eosin (HE) staining. Diagnosis was done independently by two pathologists.
Hyperplasia, dysplasia, papilloma and squamous cell carcinoma were diagnosed with the established criteria [32]. Epithelial hyperplasia shows mild hyperkeratosis and prominent acanthosis, with preservation of normal cell maturation. Dysplasia is characterized by cellular atypia, loss of normal maturation and stratification, increased number of mitotic figures, increased nuclear-to-plasma ratio and loss of polarity of basal cells. Dysplasia is divided into three grades of severity. Mild dysplasia is featured by cytological atypia limited to the basal third, moderate dysplasia by extension into the middle third, and severe dysplasia by extension into the upper third. Papilloma was diagnosed by the finger-like stratified squamous epithelial projections extending from a narrow base and supported by fibrovascular cores. Papilloma can be accompanied by dysplasia. Carcinoma was diagnosed by the invasion into underlying tissues, including those originating from papilloma or from flat mucosa.
According to histopathological diagnosis, 18 corresponding frozen specimens, including 4 frozen samples from each group of hyperplasia, mild/moderate dysplasia, papilloma, squamous cell carcinoma and 2 frozen samples from the control group, were selected for mRNA microarray assay.
mRNA microarray data Analysis
The genome wide gene expression profiles in 18 specimens were detected by Agilent rat mRNA microarray from CapitalBio Corporation (Beijing, China) and the differentially expressed genes (DEGs) among five groups, including the control, hyperplasia, mild/moderate dysplasia, papilloma and OSCC groups, were identified. The random-variance model (RVM) F-test was applied to filter the DEGs. The series test of cluster (STC) algorithm was employed to profile the gene expression time series. Pathway analysis was performed to find out the significant pathway of DEGs according to KEGG.
Real-time PCR and semi-quantitative PCR
The purified total RNA was used for real-time PCR to detect Lsm12 expression in papilloma tissues and OSCC tissues of golden hamsters as well as stably transfected cells. Briefly, total RNA was reverse-transcribed into cDNA with a reverse transcription kit, followed by real time PCR reaction with SYBR Premix Ex Taq. The reactions were run in triplicate on a 7300 Realtime PCR system (Applied Biosystems, USA). The primer sequences used in PCR were as follows:
Lsm12 (rat) forward, TCGAACAGAAACCCCTCCTC;
reverse, TTGCATAGGCCTGGCTCAAC.
GAPDH (rat) forward, CCCATGGCAAGTTCAAAGGC;
reverse, CTTGGCTCCACCCTTCAAGT.
Lsm12 forward, CTAGAGGGCCAGCAGCTCTT;
reverse, TTCCACTTGATATGGGGGTG.
GAPDH forward, GCTGAGAACGGGAAGCTTGT;
reverse, GCCAGGGGTGCTAAGCAGTT.
To measure USO1 exon 5 and exon 15 expression, total RNA was extracted from cells and reverse-transcribed into cDNA, followed by PCR reaction. Semi-quantitative PCR was conducted on a Veriti 96-well Thermal Cycler (Applied Biosystems, USA). PCR products were electrophoresed on 3% agarose gel. The primer sequences used in PCR were as follows:
USO1 (exon 15) forward, TGCCACCCAGAAAGAACAGT;
reverse, GGGACAATTGCTTAGCCAGG.
USO1 (exon 5) forward, ATAGGTTATGCTTTGGACACACT;
reverse, GAGTGACATTTTCCTGCTGCTT.
Tissue microarray
To detect the expression of the unknown tumorigenesis-related DEGs in OSCC patients, paraffin-embedded tissues of 101 OSCC cases were collected from the Cancer Hospital of Chinese Academy of Medical Sciences. We constructed tissue microarrays containing specimens from 101 cases of OSCC tumors and the paired adjacent normal tissues without a history of chemo-radiation therapy. Sections were stained with HE and diagnoses were confirmed by two pathologists histologically.
Immunohistochemistry analysis
Using immunohistochemistry (IHC) method, unknown tumorigenesis-related DEGs which were successfully verified in golden hamster tissues were furtherly validated in OSCC tissue microarray. IHC was performed according to standard protocols. Tissue microarrays were incubated with rabbit anti-Lsm12 primary antibodies (Abcam, 1:400 dilution) overnight at 4 °C. After washing, the tissue microarrays were treated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG for 30 min. 3, 3′-Diaminobenzidine was used as the chromogen. Scores were based on the % of cells with positive staining for Lsm12 (0 = 0-5%, 1 + =6–25%, 2 + =26-50%, 3 + =51-75%, 4 + =76-100%) and the intensity of Lsm12 staining in positive areas (1 + =low intensity staining, 2 + =high intensity staining). Then final score was calculated by multiplying the percentage score and the intensity score for each case, which ranged between 0 and 8. A score of 1-4 was considered as weak and a score of 6 and 8 as strong. 0 was considered negative.
Lentivirus production
Lsm12 shRNA sequences were designed according to the coding sequence (CDS) region of Lsm12 gene as follows,
CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTG.
Next, Lsm12-shRNA was inserted into lentiviral vector to yield pLKO.1-Lsm12-shRNA plasmid. After DNA sequencing, pLKO.1-Lsm12-shRNA plasmid was transfected into 293 T cells and the lentiviral particles were collected at 72 h after transfection. Additionally, green fluorescent protein (GFP)-tagged lentiviral particles containing Lsm12 cDNA or USO1 transcript variant with or without exon 15, were obtained from OBiO technology (shanghai, China).
Stable transfection
Cells were infected with lentiviral particles containing Lsm12 shRNA or Lsm12 cDNA to establish stable Lsm12 knockdown or Lsm12 overexpression cell lines. CAL 27 cells were infected with lentiviral particles containing USO1 cDNA with or without exon 15 to construct the stable cell line expressing USO1 with exon 15, named USO1-FL (full length), or expressing USO1 without exon 15, named USO1-DE15. After infection, SCC-25 and CAL 27 cells were cultured for 48 h followed by selection with 2 μg/ml and 0.8 μg/ml puromycin, respectively. Puromycin-resistant cells were selected and expanded. Lsm12 knockdown or overexpression was confirmed by real time PCR and western blotting. Expression of USO1 transcripts variants in CAL 27 cells was validated by PCR. PCR products were electrophoresed on 3% agarose gel. The bands were excised from the gel and purified. The purified products were sequenced by Genewiz, Inc. (Suzhou, China).
Western blotting
Cells were harvested and lysed. Protein extract was quantified using QuantiPro BCA Assay Kit (Sigma) according to the manufacturer’s instructions. Identical quantities of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. After blocking with 5% skim milk, membranes were incubated overnight with primary antibodies, rabbit anti-Lsm12 monoclonal antibody (Abcam, 1:10000 dilution), or mouse anti-Flag monoclonal antibody (Sigma, 1:500 dilution). Then the membranes were incubated with HRP-conjugated anti-rabbit IgG or anti-mouse IgG secondary antibody for 2 h at room temperature. β-actin or GAPDH was used as an internal control. Bands were detected using the ImageQuant LAS 4000 (GE Healthcare Life Sciences, USA).
RNA sequencing (RNA-seq) and AS analysis
Total RNA was isolated from Lsm12 knockdown or control SCC-25 cells and then used for whole transcriptome sequencing on an Illumina HiSeq 2500 platform by Novogene (Beijing, China). Differentially expressed mRNAs were screened and analyzed using Disease Ontology database to reveal the association of Lsm12 with various kinds of human diseases. GO and KEGG pathway analysis for DEGs were performed to obtain an overview of biological functions and regulatory mechanism of Lsm12.
Notably, AS changes induced by Lsm12 knockdown were analyzed. First, we selected AS events on the basis of FDR < 0.01. Then we focused on the most significant aberrant events (IncLevelDifference >0.3 or IncLevelDifference < −0.3), which were validated in Lsm12 knockdown or control SCC-25 cells using PCR. PCR products were electrophoresed on 3% agarose gel and sequenced. The AS events verified successfully were further detected in Lsm12 overexpression or control cells using PCR and sequencing.
Cell proliferation assay
To explore the effect of Lsm12 and USO1 with exon 15 on the proliferation of OSCC cells, real-time monitoring of cell proliferation was performed using Real-Time Cell Analyzer (RTCA, xCELLigence, Roche). Cells were seeded at a density of 2 × 103 cells/well into E-plate 96, which contained a biocompatible microelectrode array. Electrical impedance reflects cell viability.
Cell cycle analysis
For cell cycle analysis, cells were harvested at 70-80% confluence, then centrifuged and suspended with cold PBS. The cells were fixed in 75% cold ethanol overnight at −20 °C and stained with propidium iodide (PI) buffer (50 μg/mL PI, 50 μg/ml RNaseA, 0.1% Triton) for 30 min at 37 °C followed by analysis using flow cytometry (BD Biosciences). The percentage of cells in different phase was calculated.
Colony formation assay
Cells were digested and seeded at low density of 1 × 103 cells per well into six-well plates. 15 days for SCC-25 cells and 21 days for CAL 27 cells later, cells were fixed with methanol and stained by crystal violet solution for 10 min. After washing with water, the colonies in each group were examined and counted.
Migration and invasion assays
Transwell migration and invasion assays were performed using a transwell plate coated with (for invasion) or without (for migration) Matrigel. Briefly, 2.5 × 105 cells were seeded in 100 μl of serum-free medium on the upper chamber and 600 μl of medium containing 40% FBS was added to the lower chamber. SCC-25 and CAL 27 cells were incubated for 24-36 h and 12-16 h at 37 °C with 5% CO2, respectively. Cells inside the upper chamber had been wiped away by cotton swabs. Cells that had migrated or invaded though the membrane were fixed with methanol, stained with crystal violet solution and finally photographed under a microscope (Leica, Germany). Five random microscopic fields were counted per well and the mean was determined.
In vivo tumorigenesis assay
4-5 weeks old BALB/C nude mice were obtained from Beijing Vital River Laboratory Animal Technology (Beijing, China). 1.1 × 107 Lsm12 knockdown or control SCC-25 cells were subcutaneously injected into each of five male nude mice. 3.5 × 106 USO1-FL or USO1-DE15 cells were subcutaneously injected into each of six nude mice (3 male and 3 female). In vivo solid tumors were dissected and weight. Tumor size was measured with a calliper and the tumor volume was calculated by use of a formula (L × W2)/2, where L is the length and W is the width of the tumor. Formalin-fixed, paraffin-embedded tumor specimens were histologically observed by HE staining.
Statistical analysis
Statistical analysis was performed using SPSS 24 and GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA). Comparisons between the two groups were performed using the unpaired Student’s t-test. Lsm12 IHC scores were compared between OSCC tissues and the paired normal tissues using the paired Student’s t-test. Data are presented as the mean ± SEM. To compare the expression degree of Lsm12 between OSCC and the paired adjacent normal tissues, Spearman’s rho correlation test was used. P < 0.05 was considered statistically significant.
